Description :
From Genome Similarity Track
Location :
Scaffold_107:158381- 163520
Transcript NameFunction/comments
Hyaar_Emoy2809692hypothetical protein
Hyaar_Emoy2809693adenine phosphoribosyltransferase, putative
Hyaar_Emoy2809694adenine phosphoribosyltransferase, putative

Sequence
5139 bases(100 bases per row)
AACATACTAGTTGTCGAATTCTTCTTCGATCTCAACGCGCAAATACAGCCCCTTTGACTCCATAAAATTGAGAAGTTCCTTGCATTCGGCTTCAGTCAAA
TACGCACGCATCACGCGTAACCCATCCATATAAAGCGCCTTGCTCCATGCACAAGCGGCAATTCCACGGTATAATATTTTCTTCGCCGCATCAACCTTTC
CCAGTGCTACCTCGAAGCGCATGTACAACCTCCAGCAGAGCGCATTGCCTTTTGTCTGAATCTGGCGAACCATACTTTCAAATATTTGGCGGATACGATT
CGTAGCAGCCAGATTCATATCCCAGTAATGAAAGAGACAGCAACCCGGACGAGCAGAGTTTTCATTGTTCACGGCAGACTTCTTGAGCGTCACGGCTCGC
TCAATGCGGCAAAACTCACAAAGCAGCGCAAACAGCCACTCAACCAATTTTGGTGAATCAAAATGGCGCCGCCAGCGCTCTTCAATCTGTGCTAAATACG
TACGATGCACCTGTGAAATAGTGTTTCCCATCTCAGAATCGACAAATAGCCGAAGAAATAATTCGTTGAGCGGAAACTTATCCACTGCATCATAAACTGA
CTGGCGCCATTCGCGAGGTGCAAGCGTGGGAAACGAACCTGATACTTGGTGCTGCTGCATGAACTCCAAGTAGCAGGTCCATATCCATGCGACCTGGGAA
CACGTCTGATGTTCAGCATCAGCCAACACCACTCGATATTCTCGGCAAGCTGCTTCGAATCCGTGACAAATGTAAACGACAAGGGCCAAGTTGTGCAGAC
AGTACCCGGCCCAGCATGGCAATTGGTCGTGCGATGCAGGCTTCTCGTTGCCGATCTCTGAACCTGCTAAATTCGATGCGACGCAATGCCGAAGGGCGAA
CTTGAGCTCCACTCGGTATTTGGCAATCAGGTTTGTTTTATTCGATGGATCCGACAATAAGAGCCTTTGTAAGTAGTCTTGGGTTCTTTTCTGGTGCCTT
TTCGTAAGCGTAGACAGCGTTGCAATCTCGTTGCTGTTTTTTTGTACTGGTTGCCATACGAACCACAGAGTATACAAACACCGAAGCGTTTGGTAGTCCG
CGCTAGCACAACTCTTGAAGGCCGATGACCACATTTCTAGCCGCGCGTGCAGAAACACAAAGCGATGAATTACCCTGGACAACGAGGTATCGCTTGAATA
TCGATTCAGAAGTGAGTGCAAAGTACTCTCGCAGATACGTCGTACTTGAGTTACATTTCCCATAGTAAGCTCTAGCTTGGCATAAGCATAAAGAACATCG
AAATCGGTCTCGCCATTCGCAGACTTCTGAGCCAGGGTCTGACTCAAGCGCCGAGCAGCCACTATACTATCTCCTTGGACCATGCAAGCAACCTTAGCTT
CGAAGCCAACCCACAAGCATTTCAATTTGCTTTCGAAATCGTCATCAGCGTCGTGAAAGATATCCAACGCTTGCGCGAAGACTCGGCGTACAAACACTAC
CTTGCTAGGATCACGCAGCACATCTTGTTTCACGTCAATGCTGCCAAGGAGCGCATTTTCGAGGAGCTTCGTCCGATCAGCTGGATTAAGAAACAATGCA
TGTTTGCTAGAACCAATTGCCTGAAGGTTTAGCACAGATAGGATCGGACCTGCAAGAAGCTCGTAATCTGAATAGTTATCCGCGTATATTGAGTCGCAAG
CTGAAAGGTGAGTACTCCACAAATGCTTGCTTCTTCCATGAACGCCGCAGATTTGCAACAGCTCAGCGATAATCCGCCATCGATGCGCAGGTGAAACATA
AAACAGAAATGGCTGGACTTCCTCCGTTAGTGTAGCACGATCAGGCTGCTGCTCAATACGTTCCCGGTGTAATGAATTATTACACAGCAGTGGGGCCCAT
TGCATTTGCATATGTGCTTCTTCACGCGCAAGCCATCGCACGAAAAGGTCATCCTCATAAATCTGATCGTAACTTGCACGTTGATCTTCGACCCGCGCTT
GTGCTGCAGCGAGCACCACATGCCGCATCTTCTGTTGCTCCAACAACCGAGTTTGCCTAGCACGTGAATTCTCCGTACCCCGTAATTCGTTCAGAATACG
CTCGTATTCCTTCGAATCGTCAGCCTCATCGACAATTATGCGGTACCCGTGTAAATTGCTGTAAACCGGCGTGCTGCTTTTTTTCGACTCTGTACTTGCT
TTGTCACTTGCTGCCGATTTCGCTAAGGTTGGCACAATTTCGTTCGCTTCTTGTTCGCTTGTTCCAGGGTCCAATGATGACTTTGATTGAGGACCCCTTT
GGTACACTGCTGCGGACGAGAGCAAGTTCTGCTTGTGTTCATTCGAGCGCAATGTTTTAGAAGGGTTTACGTGATCGACAGTGGTGACGCACTTTCGATA
GACGTAGTCTCTAAATGCGCTGATAGAAGTCTCTGGCTCATCTTCTTCTAGCAATTTAATATTGGAATCAGTTGTTTCCAAGCGCTCGCTTCCAATTCTT
AGAGCGTTACCATCATTCCAATGGATGGCAAACTCCCGCAGCTTATCAGCATGGATTTCTTTGCCATTACTGTTGTCAACCATCATACCAAAATCAAGCA
GAGCTTGGAGCTGAGAGATTGCGCGTTCGACGTAACCTGCTTTTTTCTCAAACACGCACATCAGGAAGTGAAAGTCAAGTAACACGATCGATAAATCTTC
CACACGTGTGGCCGACACCATTAAATCACTCTTTCCACTCAAATTCGGAGCTGGAAGTGCCGACGCAGCTGTCGCTTTGTCATATGTTGTACTTTGTGCT
CGCAATACTGTTAGTATGCGTGCGTACAAATCGCGCACGGACTGCACCGAGAATTCACCAAATCGTTGGTGCCGACATTGAAGGAGCTTCAGCCATAGTT
CACTGTTCGCTGGGTCTTCAGATAGGAGACCCTCTATCTGCAGCTGAATTAAGTCGACATCACTGTTATCTCCCTTTGCTGTTGTTTGCAATAACATGTT
CAGCTTTACACGGTGCAGCTCCCGTGACTGAGGATTAACAGCAAGCGCTCGTGCTAGTATTGCCGCTTGTTTCTCCAAAATGCTCGTCTTCGTAGCAAGA
TGTATATTCGGCTTCGTGTGGAGATTAATCGTCTGCTCCTGAAAAGCCATCAAATCGAGCCAGCAGCTACTGCTCTGTGAGTTAGCAGCTATAGCAGCAT
TAAGCGTTTTGCTGCGTCTCACCAGATGCTGCTCAACGCTTTGTCCGGTGGTTAGCAAAGGTGTATCGTCAACAACCTCGTAACCGGTACCAGAGCTAAC
TAGCGCATCGATGTCCAGCACCGGATCCAATGGAATAAAAGTCATTTCACCTGGTCGGCTCTCATTCATAGCACCTGTCGAATCCAAATAGACCCCTTTA
TGCACCGCCCGCGCTTGTCGCTTCTCCGAGTAAGCAAGATACAGACGTCTTTGTCGGGCGTTTCTCTCCAACTTCCGTGCCTGCAGCGAGAAGTATCGAC
CAGAGTCTGTTGCGCCTTTCGTATGATGGATATATGTTGATACTTGGTTTTCCCATGCGCCTGTAAGCAGGTTTCGTTGTGTGGCCAACTGGTAGAGCGG
TTGATCATGGACGTACGTCGATCCAAAGTGTTTGTTGTCGCAATCACCCATGCGGTCAAATTCAAACAGTTTTTCATCTTGACCCGAAGTTACTTGTCCG
TGGTGTACGACCATATCGCTGGCATCATTGTAGCTGCGAAGACCGGTCCGAGATTGAGGTTGAGAGCGCGATCGACTGCGACCACGTTGTCGGCGCCGCT
CAGAGCGGTACTTTGTGCAGGGAGATACACTATTATCACTGCCTTCACATGAACTTAACGACTTCTGTTTCTTCTTGCTCTTTTGCTCCTTCTTTTCTTT
CTTTTTCTTCTTTTTGTGCAGCTTTAAGAGGTGTTGCGATGGCTCAGTCGTTGTCTCTTCGTCGAGGCGTCGCCTCTTCTCTTTGGGCTTTTTCTTTTCT
TTCTTGCTGCTTCTTTTAACACGTGTCGATGTTTGGACCTGCAGTGCCGACTCCGACAGCTCTACCACCTGACTCGGATTCGTCGTATCTTCGCGCTTGC
CGGTCGCGAAACTCTTGCCAATGCTCAGCCAATCTACAGCATATACACACAAAATTATATTTAATTGATAATGAACAGCAGCTTCCCATGTTAATCGGCC
TACCATCTGCATCCTGTCCAGCACCTCCGTCCGCTGCCGTAGCGTCTTGAGGTTCATTGGTCGAACCTGCTTGTTGCCCTGCTGCGAACATCGAATGGAT
TTTTTTTTTTTTACATTACAATTGGTTAAAACTACAAGTTTATATTCCCATTATTATATATCTCCGCGCTAAAGCCTAAAAATGAGCGCCAATAACGTGC
CCGTGGACTTGGCGAATGGCGAGGCGGTCTCTGCCTACATCAAGCAAAAGATCCGCGTGTTCCGTAACTTTCCCAATCCTGGTGCAAACTTCAGCGACGT
CACGTCCCTATTGCTAGATCCTGTGGCTTTTCAAGTCGTCATTGATGCTCTGAAACGTCGATACATCGACCAGCGGATCACGCACGTGGTAAGCTGCGAG
TCGAGAGGATTTATCTTCGGTGCTCCGTTAGCACTAGCCCTTCAAGTGGCTTTTGTGCCAGTACGTCGCGCTCGTCGACTGCCAGGTGATGTCGTGGGAT
TAGACTACGTCTCTGGCTTCCACACCGGTCGCATGGAAATTCACCAGGATGCCATCACGAGCGGAGATCGCGTTGTGATTATTGATGATCTCGTGGCATC
GGTACGGTAGTTCAGATAACAACGTGCCTTGTTCATCCTCTCTCTATTCCTTTATGTTGATGCAGAGAATTGCTTACTCGAGCATAATACTGTTTATTTC
TATTGCTAGGGCAAGACACTAAAAGTTACGGTTGAGCTTGTTGAACAGCTCGGTGGACACGTTGTGGAGTGCGGCTGTGTGATCAATTCGCTGCAGTCAA
CGGTGCGTTGCGGGCGCACTGCATTGCACCAACCATTTTGTATCTCAATGAAGCTGCTGACGACTTGACTACGTTTTTGTGCTTATCCATCCAGCAATCA
CTCCTTAAGATCCCGCTTTACGGTCTCACTCAGATATGA