Description :
From Genome Similarity Track
Location :
contig_61:158375- 159938
Transcript NameFunction/comments
g10860.t1hypothetical protein

Sequence
1563 bases(100 bases per row)
CTACAGCCCGCCGATACACACCATCTTGGTCTCCAAATATTCCTCCAGGCCTTTGGGTGAACCCTCACGACCAATCCCAGATTGTTTCATGCCGCCGAAC
GGAGCCCCGATGTGCGTCACCAACTCGCTGTTCACGCCGACCATGCCGCACTCCAACTCACCAGCAACGCGGAACATGCGAGCCGCGTCTTGAGTGTAGA
AGTACCCCGCAAGTCCAGCAGGCGTATCATTCGCCATACCAATGACTTCCTCCTCACTCGAAAACACGAACAGCGGGACCACGGGACCGAAAATCTCCTC
ACTCCAGATACGCATGGACTGGTTTAAGTTGCTCAGCACGGTGGCTTCATAGAAGTTCTTGCCGAGACCGCTCGACTTGCCGCCGAGGAGAACCTTGGCC
CCGTGAGCCACGGCGTCTCCGACTAAGCCCGTGACTTTCTTGACAGCTGAAGGCCCAACCAGTGGCCCAAGCTGCACCCCTTCTTCAAGAGGAAGCCCCA
TCTTGAGAGCCTTCACGCGCTTCACCACTTCCGAAGCAAACGCTTCGTAGATGGACGAGTGCACGAAGATGCGGTTGCTGGAGATGCACGCTTGGCCCGT
GTTTGAAAACTTGGTTCGGATCAATCCGTCGAGAGCTTTCTCCAAATCGGCATCTTCGAACACGATGAACGGTGCGTTGCCGCCCAACTCAAGCGACAGG
CTCTTCACCGTCTCGGACGAATGACGCAGCAGCCATTTACCAACTTGCGTCGACCCCGCGAACGTGATTTTTCGGACGTCATTGCTCGAGGTCAGCGCTC
GACCGACTTCTTCCGACCTCTCTCGTGGGGCAGTGATCACATTAATCACCCCCGCTGGGAACCCCACTTGTTCCGCCAGCTTAGCCAGAGCGAGCATCGA
GAGTGGAGTCTCCCCCGCAGGTTTGATCACAGTGGTGCACCCAGCAGCCAGAGGCGGCCCCACACTCAGCCCCAGAATGGCGTAAGGGAAATTCCAAGGA
GATATGATGCCGCACACACCCACGGGCTCCTTCATAACAAGGATCTTCTGGTTCGACTGAATCGGCGATATCAGGAACCCGCTGGAGCGCACGATTTCGT
GCGAGAAATACTCGATCACACCAACCGCAAACTCGACCTCCCACTTGGCTTCTAGCAGTGGTTTCCCGCATTCAACGGATCCGATGACCGCCAAGTCTTC
GGCATTCGCAGCGATAGCAGCAGCCCATGCTTTCAGCAGCTTCGCTCGGACCTATTCGTCAAAACAGCATATCAAGCATCACCATGACGGCAAAGACGCC
GATACCAAGTTCCAGTTATGAGGTCTTACCGGTGGCGTAGTCTTCTTCCACTGACGTTGAGCAGTTGACGCAGCAGCAATTGCATCGCGGGTGTCTTCTC
CTCCCATACTAACAACGCGTGCGACTTCTTGTTCCGTTGCAGGGTCTGCACCATAACAATGCGTCTCAGCAGCAGAACGGACCCAGTGAGTCATACAACA
CTTACCCACGACGACGAAATGATCGTTCCCGTGTGCCTCAATCCATTTTCCATCGATAAATCC