Description :
From Genome Similarity Track
Location :
contig_31:158337- 160211
Transcript NameFunction/comments
g7476.t1hypothetical protein

Sequence
1874 bases(100 bases per row)
AAAAAAAATTACGCAATTGTTCAGCACTTCTGTCCGCACCTAGATAGCTCTGCTTGGGTCCCATCCTGCTCCGTCAGCAGGCCGGCTCTTGATTCTTTTA
ACAGCAACCACCCGACTTCTTCTTGCCACCTCCGTACGGGTCCACGATCTCGGGCAGCGCGTTGCTCTCGGCCGACGCCGTGGGCAGCGCCTGACTGATC
TGGATGAACAGGTCTGACACGTTCGTGTCCTCCTTGGCACTCGTCTCGATAAACAGCGCACCGATCTCTTCGGCGTAGGCCCGCGCCTGGGACGCCGGCA
CCTCGCGCTTCTCCTCCAGGTCGCTCTTGTTGCCGGCGATGGCGATCACGATATTGTCCGGTCCGAGCTGCTTCAGCTCCTTCACCCAGTTCTTGAGCGT
CGTCAGCGATTGCTATAGCAACACAATAAATATTAGACATGTACATTGCAAGTAAATAATACTAAAATGCACACCTTTCTAGTGATATCGTAGACCACGA
TGGCGGCGGCTGCTCCTCGGTAGTACATGGGCGCCAAGCTGTGGTACTGTAGGGCATCAAATAGGAAGGGTCATCTTTTTGATCGCACACTACATCATAA
CCAGGTTTGAGAGAACCTTTTCCTGGCCGGCGGTATCCCAAATCTGATACTTGATGGGCGTGTCGTTGACCACGATCATCTTGGACATGAATGACGCGCC
GATGGTGGACTCCGAGTACGGGCGGAAGTTGTTGGTCACGAAGCGCAGCACCAGCGACGACTTGCCCACGCCCGTGTCGCCCAGCAGCACCACTTTCACC
TCGCGCGCCTTGCTGTTGCCTGCGTCTGCCATTTCTAGTGCTCCTTCGGGTCTATCGTGTTGTTCTCTCTCGTTTTCTCGCTCTTTGGGTGGACCGTAGA
TGCTAGGTTAAGTACGCTAAAGAGAACAGTGAGAAACGGGGTAAGTACGAATAACAGACGGCACGGTTACTGGCGGTGTCGCTATTGCAGCAACGTTGGT
GTTGCCCTTTGCGGTGAGTACATATTGTTGGTGAACGCTTTCGGCAGCAATGGCTTTGATTCGAAGTTGGATTCATTGGTATGCACTGTTCGACAATCGA
CTGCGGACACGAAGCAGCGACGGCCGCTCGATTGTCGATTGCTCGTCGTTGAGCCGCTCCGCCTCAAACGTATAGGCTCCCTAGGATAGTCTACACATTG
CGGAGACAGGCCTCGAGGCGTCGACCAACCCAACGATGGCATGCTCTGAAATGGCTACCCAAGAGATCGCCATGTGAGTCTCCATTGCATGTGTAAATTA
CAGGAACTGTACCTGTAATAGGTCGCTGTTGCTGCAACATTTGTGCAACTTAACAAAGCAAGACGTAATTACCCTTTTTACGAAACGACTGGCTGGCAGA
ACGGAACCGCCCAACCAGACGCGTCAGTTGCAGATTTCGGCTTGCATCGGCATTGTTGGTCTCGACTCCCGTCGGAGATTCCCATCGACAGTGTGCGCCA
GAGGCGCTTGCGTATATGGTCTTGTGTTGTGGTCCCAGTGATTTTTATAACTCTAGAATTACACTGATCCAAGTGATGATCATTTATCCAGTTGAGGGAC
CCAACTTGTTGTACTAGGGTAGTGAGGAATTGGCAGATCAGGGAGAGCTGCGTGTGAGAGAATGATGAAAGTCTAGCTTTTTTTCTTAGGAAGTGCCGTC
AGATCATGTTGAACATTATGACGACAATAAGCTGTCGAGCTCCTCTCGGGGGGCTCCTGAGACTCCACACAAAGCATCCTCTATCTCTCTACTCTGCATG
TCCGTAAGTAGTGTCGATGCTAAAGCAAAAGCGATGCATGTCCGCATCTGCTTCACCAAGGCCAAAACCGCTAG