Description :
From Genome Similarity Track
Location :
contig_31:158323- 160197
Transcript NameFunction/comments
g7131.t1hypothetical protein

Sequence
1874 bases(100 bases per row)
TAAAAATGGGCAATACTCGTCCAAACACAAAATCAAAAAAAAAATTACGCAATTGTTCAGCACTTCTGTCCGCACCTAGATAGCTCTGCTTGGGTCCCAT
CCTGCTCCGTCAGCAGGCCGGCTCTTGATTCTTTTAACAGCAACCACCCGACTTCTTCTTGCCACCTCCGTACGGGTCCACGATCTCGGGCAGCGCGTTG
CTCTCGGCCGACGCCGTGGGCAGCGCCTGACTGATCTGGATGAACAGGTCTGACACGTTCGTGTCCTCCTTGGCACTCGTCTCGATAAACAGCGCACCGA
TCTCTTCGGCGTAGGCCCGCGCCTGGGACGCCGGCACCTCGCGCTTCTCCTCCAGGTCGCTCTTGTTGCCGGCGATGGCGATCACGATATTGTCCGGTCC
GAGCTGCTTCAGCTCCTTCACCCAGTTCTTGAGCGTCGTCAGCGATTGCTATAGCAACACAATAAATATTAGACATGTACATTGCAAGTAAATAATACTA
AAATGCACACCTTTCTAGTGATATCGTAGACCACGATGGCGGCGGCTGCTCCTCGGTAGTACATGGGCGCCAAGCTGTGGTACTGTAGGGCATCAAATAG
GAAGGGTCATCTTTTTGATCGCACACTACATCATAACCAGGTTTGAGAGAACCTTTTCCTGGCCGGCGGTATCCCAAATCTGATACTTGATGGGCGTGTC
GTTGACCACGATCATCTTGGACATGAATGACGCGCCGATGGTGGACTCCGAGTACGGGCGGAAGTTGTTGGTCACGAAGCGCAGCACCAGCGACGACTTG
CCCACGCCCGTGTCGCCCAGCAGCACCACTTTCACCTCGCGCGCCTTGCTGTTGCCTGCGTCTGCCATTTCTAGTGCTCCTTCGGGTCTATCGTGTTGTT
CTCTCTCGTTTTCTCGCTCTTTGGGTGGACCGTAGATGCTAGGTTAAGTACGCTAAAGAGAACAGTGAGAAACGGGGTAAGTACGAATAACAGACGGCAC
GGTTACTGGCGGTGTCGCTATTGCAGCAACGTTGGTGTTGCCCTTTGCGGTGAGTACATATTGTTGGTGAACGCTTTCGGCAGCAATGGCTTTGATTCGA
AGTTGGATTCATTGGTATGCACTGTTCGACAATCGACTGCGGACACGAAGCAGCGACGGCCGCTCGATTGTCGATTGCTCGTCGTTGAGCCGCTCCGCCT
CAAACGTATAGGCTCCCTAGGATAGTCTACACATTGCGGAGACAGGCCTCGAGGCGTCGACCAACCCAACGATGGCATGCTCTGAAATGGCTACCCAAGA
GATCGCCATGTGAGTCTCCATTGCATGTGTAAATTACAGGAACTGTACCTGTAATAGGTCGCTGTTGCTGCAACATTTGTGCAACTTAACAAAGCAAGAC
GTAATTACCCTTTTTACGAAACGACTGGCTGGCAGAACGGAACCGCCCAACCAGACGCGTCAGTTGCAGATTTCGGCTTGCATCGGCATTGTTGGTCTCG
ACTCCCGTCGGAGATTCCCATCGACAGTGTGCGCCAGAGGCGCTTGCGTATATGGTCTTGTGTTGTGGTCCCAGTGATTTTTATAACTCTAGAATTACAC
TGATCCAAGTGATGATCATTTATCCAGTTGAGGGACCCAACTTGTTGTACTAGGGTAGTGAGGAATTGGCAGATCAGGGAGAGCTGCGTGTGAGAGAATG
ATGAAAGTCTAGCTTTTTTTCTTAGGAAGTGCCGTCAGATCATGTTGAACATTATGACGACAATAAGCTGTCGAGCTCCTCTCGGGGGGCTCCTGAGACT
CCACACAAAGCATCCTCTATCTCTCTACTCTGCATGTCCGTAAGTAGTGTCGATGCTAAAGCAAAAGCGATGCA