Description :
From Genome Similarity Track
Location :
Scaffold_14:15826- 17099
Sequence
1273 bases(100 bases per row)
TCATGATTCCAACATCACCACGTATCCTGGTGCTCAACGCGCGTTCTTACGCATCGCACAATAGTATCATTGGCCTACATTAAACCAAGATGTCCAAGAT
TAGGTAAAATGGTGGAACATGCACTCGCTGGAAACACAGCAACGCTCAAGACTTATGTTGGTTGGTTGTTTCGATGGATTTCATTACGGGATTACCGAAA
TCAAACGGGTTAGATGCAATCATGACGGTTGTCGACAAATTGTCCAAACGGCCAAAGTATCGTGCATGCAATCGCACTGATGATGCTCAAACAACAGCTT
TTCATTTCTTTGACTGTGTCGTTCGTCATCATGGGTTACCATCAATCATTATCAGCGATCGACATTCCAAGTTTGTTCCGAGGTTTTGGTCACCTCTTGC
TAAGTTGGTGGGAATTCATCACCATATGACAGCTTCTTATCTTGCGCAAGGCGGAAAAACCGAGCGTCAGAATTTGATTTTGGAAGACGCTCTACACTGT
ATGGTGTCGTACCATGGAAGTGATTGTTCTGTTCAATTCAGAACACTTGAGTATGCTCATGCTACTCTCGTCAGCGCATCAACGGTTTTGTCGCCTTTTG
CACTGGATACTGATCGCAAAGAACGCAACCCCTTGAATCCGCTAAGTTCTCCTAGTGCTTCAAGGAAGGTGCAACATGGAATTTACTAGTATGCAAAATA
GTTTCATGACTGTCGTCAATAGTTCATTCATGTCACCACGAAACATTTACTTCAATCTCAGGATCGGCAAATGAAGTACTACTACAGGAAAATGACTTAT
AAACCTTTCAATACCGGATCTTCAGTTATGATGGATACTTGCCACATGCCTGCTAAAGATGTGACACAAGACATTGATGGAACACGTGTCAAATTGGCTG
CTCTCAAAGCTGCACCCTTCCAAATTACGAAAATGACCAGCACGAATGTGTCGAACTTAAACTTCAGCGAAGTATAAGTCGTTTGCATTCTACGTTCAAT
ATTGACGTATCGAGTCATTATGTTTCAAATCCATCGCGATTTCCAACTCGTCGGATCTCAAAATCGTCCCGACTTAGGTGTTGACACGATGCATATCATC
GAACAGCTACTTCGAATGCGTCATTTCAATCCCAAACCGGAATGGCTCGTCAAGTGGCATGTATTACCCGATCATGACACTACATGGGAGCGTGAAAAAG
ATGTTTGCGGTATCTCATTAAGAGGTTCACATGAAGCGGCAACAAGAAGTCCAGTCCAGAAGGATGTAATAAA