Description :
From Genome Similarity Track
Location :
contig_60:158245- 166481
Transcript NameFunction/comments
g11169.t1RAW43620.1 hypothetical protein PC110_g161 [Phytophthora cactorum
g11170.t1RAW43619.1 hypothetical protein PC110_g160 [Phytophthora cactorum
g11171.t1hypothetical protein

Sequence
8236 bases(100 bases per row)
TCTGCGCGAACAGAGCCGAGCATTCCATTAGCTCGATCTTCAAAGGACGTAATCGCGCTGATCATGCTGCGCTGGACGTCGCAGCGCCCGCGTCCACGAG
GACGCTGAAGCCTCATTTCTTGCAGCGGGTCGACGGCAGTGCCGCAGACAGCACACACTGCGTGAGGTGGTCGGTCCAACTGCACTGACGAATTCCAGTG
CAACGTGCTTCATGTCGGCCCACTGCTGCGTGCAGCTCGGACAGTGCGTGCGCTGCTGGTGCCCTCGAATCTTCTGCAGCATTTGGTCGCCAGCGGCGCG
AACCATTCGTTCCATCTCGGCTTTGTCCTGTCTCGCCGCGGTAGACTGCGCATAGCTGCTGGTTGCTGTCCGTAGTTGAACAAGACAAGCAGCGAAACGT
TAGTGACCGATATCCAGTGCAAGGCTGCACAGCACAGGAGACGGAATCCGGTGTACCGATGCGTTGCCACTTCTTGAGTTCTGCGACTGCACTGTCCAAG
TCGCGCCGGATATGCTGCATTTGCTGCGTGGTCTGCTCGAGTTGCTGCTGTCGACGCACCAAATCGTTCTGTAGGCGAAACGAACGATTTGAAGTCATGT
GTTGGATTTGGTAGGCACGCTCTAGCTCACATCGCATTTCTCTCAGTCGCTCTGGAATTCGCGAGGCAGTAGTTGTCTGCTGCTCGTTGCGGTTGGAATT
AGGGCGAGTCCGAGGTATGGCTTCACGATCAACCACTGCACCTCCAGACGAAAAGTACAGACGCACTATTTTCTTAGCTCCGCGCCGGCAAACAGGACAA
ACTCGTTTGCTTGCTAGAGCTTGTTCCGCACACGTGTGATGAAAAACATGGCCGCAAGCCAATGCTGCCAAGTGTATCTGCAAGCTTTCTAGGCATATAG
CACACTCGGTGGACGCTTGATCTCTTTCTCCGTTCTCGCTCTTGGGCATTGGTGGGGGTGATCTTTGTTGCTCGTACGAAGATGGTGAGCCAGGAAGTCG
ATACGACATGCTTTGTGAATGGGAACTTCTGAGTGGTCTCATTCCTTGCCAGCGCTTCGATGGGAGTAGACGCAAGAATACAGCAACGTAGCTTGCGTCG
TGTCCCTGTTGGGCTTCTTCAACGAACATCTTTCAAATGGCGATACTAGTATTGTACTTTTTTGAGTTCTATGTATACTATCTCTGCGTTCAGGCTGCAG
GAACAGGTCTGCCTAGATATGCAGCATAGCTGCGATGTAGGACGCGCTGGGGCGTAGTGACGGATCGTATTGCAAGCATGCGACTGCCAGCTCTCGGACC
ATCGTGGGACATTCAGGTGTGAACGTGAACATGCCCATAAAACTCGTGTCATCGTTGTTGTGTGCGCCGAGCAGAGGAGTGGTCCGTCGGCGGTTTTCCT
CCAGCCCAACACTGCGCGAGCTTTGCAGCGTACGCGAGCTGTTAGAGCTTGGCAGGCTCTCCAGCTGGGTGGTACGTCGTCGTGAGCTGTCCGAGTCACT
GCCAATGTTAGTTGATACAACCGTGCCGTCCGTAGAGAGGAGAGTGCCGTTGTCCGTGTCGAAGTCACCAATGTGCGTACGCATCCTCCACGAACTTCTG
ATCATTTCGTCTGCTGTCTGGCAAGTGTCCAGGTGTGCAAGCAGCACGCCGAACGCGTACATGTCCGAGGACGACCGAGACGGCTCGCCGATGAGGATTT
CAGGAGCGAAGAACGCCTTCATGGTGGAATCGCAGCTTTGATAGAATGACTGACAACTGTAGGGGGATGATCCATCAGTGGGAAGAGCAGCCTGCACCGG
GTTTAACTTGCAGCCCTTTTTAGGGTCTACAAACACGCTTCGGCCATTGAGCCCGTCGTACGTAACCATGTGCTGGCTGTGCAGGTACATGAGGCCACGC
GCGATCTCGGATGCTGCTTTCATCTTGAAGTTCTTCCAGTTCAGCTCTGAACCAGAACTCCTCAGGTATGCTTCAAGCGTTCCAAGCGTCATGTACTCGC
AAACTGCTGTCATCGCATGTCTTTCGTCCCACACCAGTCCAGTGATCGAAAGCAATTGCGGGTGACGCATTTGCGAGAGTGTTGGCACCATGTCTAAGGC
CGCCTCCACATCGTCATCGCTGGTCTGGAGTTTAGTCACAAGAACCAAACGCGTGCAGTGTTCGGCAAGCGCAACGGTAATAGGGCCCGACATTGACAAC
TGATTCAACATGACGACATCGGTGGACAGGATCTCCTTGAACGCCGCCTTGCGTAGTCCACCACCGGTGTGGAACTCATTAAGTGAAGCCTCAAGCTCAG
TGGTCTGCATAGTGCTATTTGATAGCACACCCATCCGAGATCGAAGGCTCCGCAAATTCGACTTGATCTTGCTATCACCAGATACCAGCGAATCGTGCTG
CTGCAGTGCTGTCTTTTGTTTATACTTTCGCAGGAAAACAACACCCGACCACGGCCAACACCACGAAAAGCGCAAGCCCCAGAACGACGAACAGAACAGC
GGAGCTATCTTTGCTCTCGGTTGCAGTGGATGTTGTACTTTCCTCTTCGGAACCGGAGCTGTTGATACTGCCGAGACCGTCACCATTTGTGTAGCACACG
CTTTTGTCCGCCCAGGATACGGCTTCATAACCAGTGGAACAGCTTCCGGTGACTGTCAAATTGGCTTCAAACACGGGCAGATCCTGCAAATATTGAAGCT
GTGGGTGGGTGACGTGGGCGTCCGTGATAGCGTTGCCTTGTAGATATAAAGCTGACAGGTTGCGCATTTCATAAATAATGGTTGGGATATCCGACAGCTC
GTTGTCACGAAGGTCTCTGTAGAAACAAAGGCTGTCGTTAGTATACCATCCCACATCTCATTATGAAACCGCACGTACAAGGTTGACACAGACGTGAACG
CATGCTCGCCACGTGGATCAAATTGAGTGAGCTTTGACCGCTGAATAATACTGTGCATGAAACGAGATAAACTCCAGTCAGTTGACGCTGGCTGGGTAGC
CGAATGCGGGTGTGTAAATATCAACATACAGAGACTGAAGACTGTCCGGGAAGACGTTTGTGAGAATTTCATCGATATGAACATCAGAAATGGTTCTGTA
GGAATAACAACACAAAGACTGTCAGTACAAAAGTTCATCCAGATAGCGTATCAATCGCAGCTAAGCACACACATTTGCTGCAGCGCAGTGCCACTCCGGA
AAGCGTCCGACGAAAAAGAGAGCGGGACTGCGATCTGCGAGTTTGTCGTCGCGGTCACGATTGTCCTACAAATTACAACAAGACACCGGAAAATCAACGT
TAGCAAATACGGCACGCATTCTTTCCAGGGAGCAATCGCCACGTACAAATTCTGCAAGCTCGACGGCAGCTCGAGGTCGTCGATGGCTTGAAACACGGCC
GTGTTGGCCTTGTCGCTTTGTGGCTGGGCGATCGTCAGCGTCCACTGCGGCATGCTCCAGCTTTCTGGCGTGTCCACCAGACACTGCACCTCACACTTGC
CAGACGTGACGTCCGTCTTGCACGTGGGCATGTTGGCATACGCACAGCCCCGGTAGAAAAAGTTTCCGTCATTGTTGTTGTTCTCCTTGCTCCTGTCCCC
AGTTGTCGACGCGTAGTTGACACAGAGCGAAGAGCTGCAGGCTCCGTAGCAGTTGCTCGTGAGCGTGTTGCTCTCCGGAGGGGCACAGGCCTCGTCCGCT
GCAGCGACTGCCACGGCCAGAGCTGCTGCAAACGCTCGGACGCTCCACATTTCTCGCTTGATTCTGCTGGCTTCGCTAGAAAAACACTGGACGCTTGCTC
CCAAGCGAACGCTGCGGCTGCTGAGCCCTCGGACCTGGAATGGGCAAGGCACACACGAGTGTTGCGCGACAGCAACTGGCACGAACTCCACAGGACAAAT
GGTGCTGTGAGTCGCTCCACGGAAATGTCTCACTGAATTGTGCATAGCCAGGAGGTAAAGCCAGTCGGATTTCACCTGTTCAATTGGTCAAAAAGCGGGT
CTGATAATTGTTCTGGTTGGTGGAAAAAGGGAAACCCCGTAACGGCGATTTTGACTTGGGTTTACTATGGCGATCGTTTTTCGCCGTTTTTCGATGGTGG
TCGAAATTCAACGTTCACCTTTCCACCTTTTCTTGCTGGTTGTTCCTGGTGTTGATGGGGACGTCGAGTGCATGCTGGGCGCTGTCTCTAGTTGCTCAAT
TGAAGATGCCGCGATCGATCTTTGAGTAGAGTCGATACTCTTTCGTGCGGTTGAACTCGCAGTCGTTACCACGGGCCTTTCCGAAAGACCTTTCGTGGCC
GCAGGGTGAACACGACCACGCCAAGTAATTGTTGCTGCTGCTCGCCGCAGCGCAGCCTCACTGCAGCAGGCCAAAGTGCGACTGTATGTGCATGTACTAA
TACCGATGGCATCTCAGCAATATTGGACACACGATCGGATCGAACGTGAAGTCCATTTACACCTGGCTGTGGTCGTGTGGCTGGGAAGCGAGAGGTGCGT
CTGGGCGGTGCGGCTGTCGTCAGGCCTTTTTGACGAAGTTCGAGCAATCGTGGCCGTGACCATCTCGAAGCTGACCAAATGACCACCGTCATTTCGCTGA
TTTGGTCGATAGGCGTGACATGTATCTGTACAATCGCATGCTCGTGGATCGCCCCCAAAGTACATAAAAAAAAAAAACCAATACTTCATTCGTACACCAA
CCGAGGCGTGTCCTAATATAGGACGGATTCTACTTCCGGACGGGTTCTATTTTCCAAAACGGTTGTCAACGTGCGTCACCAAGAGCTCAAATTAGACGTG
CTCCGCTATTTACAACTGCGACAGGTGATCTCCACGCCTGACCGACAGCGACGAGGGGGGAGTGATCAAGCAGTCTGTTCAACGAAGCCGTATTCCAAAC
CCCATGAGCGCGCGAAGGTTGCGCGAAGCGACCAAGATTACACCTCGCAGTGCCGTCGGTGCGCCGCTGCCTTGCTATATTGCCACCAAATCCTCAGTCC
ATCTGAATAATACATTCTCTTGATGTGCAGGTACCCCGCACAAAGCTGCTGAAACTGAGCACGAGTATTTGCGACGATGTGTGGACCCGGTCCTGATGCC
CCTTATCGAGTCGTTGCTGCTGTATCAGCCGGAGAGCGTCTTCCACTTCATCCTCGACTTTGTGGACGAGCAGAAGGCCGGTCGCTTTACGCACCACCCG
CAAAGCGTAGGTTACGCGAAGAAGCTCACAAACCGCCGTAAAATGGTGGATTTCATGTCCACCAGCGTGATCCCCGTCATGGACGATCTAGCCAAACAGA
TTCTCCGCGAGAAGCCAAACTCCGTGAAAGGTGCGTCGTGGCCATTTTTACTACGTACTTGTGTTTGACTTTTAACGCTGACCTGTCCCTCGCGTGAAGC
TTTCATTAAGGACGTGGTTGCTGCGCGTATAGTTATCGAGTCCAGCGAAAGCCCCGAAGAAGCATCAAATCAGCTTGAAGCCCATGTTTACTTCCGCATA
AATGACCGTGTATTATGTCGGTATAAGGGTCGACCACGCTTCTTTCCAGGTATCATCACTGCAACCGATGACAATGGCAGCTTTACAATCTTATACGACG
ACGGAAAGACAGAGAGCAATGTCCACTACATGTGCCTGAGACTGCACCCGACACCGAACTCCAGCGAGACGGCGGCAACACACAAAATGGTTGATGGAGA
AGTTGAGGACAATCAGGAAAAGCCGAAGGCCAGTCGCAAAATGGAGATTGTGCTTTTGATAATTGGTATCGACGGAGCTGGGAAGACTACGCTCCTTTCC
ACGTTGCAGGGTGATCTCGACAAGGAGCATGTGCCCAGTGCAGGCTTCACGTCTGCCAAATTTCAGACTGAGACAGGATCTGCTACATTCTACGACCTCG
GAGGCGGCCCAGCGTTCCGCAACGTCTGGAAAGAATACTACGCTGACGTACGCAACTTGGATGTTGATGTCCTAAATTGATATTAACTGTCACATGTTGC
GTCTTGCCCAGGCTCACGGCATCGTTTTTGTAGTCGACTCGTCAAGCGAAAATTCAGTGCTCCAGGCTGCTAATGTGCTCGAAGAATCGATGGCGAACGA
TCTCATGACCAACAAACCTTTGCTAATGTACGTGCAGCTCTGGGCTCAATGAAAGGCTACGTAATCCCATGCATTAATGAACAACTTGCGTGCATCATAC
AGCTTTGCCAACAAACGCGACCACTCCAACGCCGTAGGAGAGCAGGAGATGCAACGTTTACTGCATCTGAACAAGTTTCCCGGCTCTAAGATTGTACCCT
GCGTTACCAAGCCAGCCGTCAACGGTGGAGCGGTAGACGAGCGCTTGGAGACCGGTCTTGAGTGGCTCTTTGAACAAGTTCACAATGACTTTGACACACT
ACACGAACGGGTTCAGCGCGATCTAGCACTAAAGAAAAAGCAAGACCAGCAACGGCGAGAGGAGCAACGGGCTCGAGTTTCGCGTTGGAAAGAAGAGCGT
GAACTTAACCAAATGCGTACTTTTGACAAGCCGTCCATAGAGGAGCAAACCCCATCGTCGTCGAAAGCTGCAGCGGATAGACCGGAAGAGTCCGTGATAT
ACTGCTCAAACTGCAGTACAGCGCCAGCAGTAACGAAGTGTGCTGCATCTAAGTGGATGCCTGTATGCGAAGACTGTGCAACAGCTTTGAGAAGTCAGTC
CACATAAGGTTGAATCAAGAGATGCTACACCGCAAAAGCAGCGATTTTGGATTTCAAAGGAGCTCTCTATTCTCTATCTCATCCTCTGCGCTTCTTGCCA
CCCTTCTTACCGCGACCTCGCTGCCGCTCTTCGTCTTCTTCTTCCTGTTCTTTCTTTGAGCGCGCGCTGTTCATGATCTTCTCTACATTCTCCTTCTTCT
TGCTTTTTCGCATCTCCTTGCGCTCCCGGCGCTTCTCGGCTGCCTTTTGCTCCTTTTCAAGACGCACACGCTCAGCCTCTTCCTTCTTACGAGCGGCTTC
ACTATCCGCTTCCTGCTGCTCAGCATCAGCACTATTGTCATCATCTTCCGCAGGTGGCTGAGCAGGAACGTCATTTGCATTGTCAACCTCGCGCTTCACC
TTACCGAGCGCGATAAGCTCCTCCTGCAATACTCGATCCATTTCATCGTCCAAAAGGCTGAGGTCACTAAATACACCAAGTTCCTCCTCTTTCTCGCGGT
GTTTCTTCGACGTGAGGTGGTTCTGCAACTGCTTTGTAGACTTGAAGGTCTTGCTGCACAGGTCACACACAAGAACATCCGCGTCCATTTTCTTTCGGAG
CTTCTCAAGTTCCTGCTCAATGTCTCTGTCGGCAACACGGCTGGTCTCCATACCGCTGTCGGCCCACATCTTCTCCTGCTGCTTCTGAAACGCGCGTCGC
TCGGCGTCATACGCCGCTTGTTTCTCGCGCTTCTTCGCCTCTTCCTCAATACGCCGCTGCTGCTTCTCCTGCTCCTTTTGCTTCTGAAACGCTCGCACAC
GCGGGTCGCGACGGCACACGAAATCCACAAGCTCTCGCACTTCAGTAGTAAATGCCTTCTTGGCCACATCCCGCAGCTTTTTATTCTCCTTCTCCATGGC
CCGCCTCACCAGTCTCGTGGGTGCATCGGTCGTTTTGTACTCATCCACCCACGCAAAGCTGCGCTGTGTCGTGTAGCTCTTCCAGTGCTGGTAGAAGTAG
TTCACGTCGTCCATCGACGTCTCAGCGCCTCCGATCTTTGGAGCAGCTGCGGATCTGGAGCCGTCACCTCCCTCCACGTCCAGCTCATCAATCTGTCTCC
AGCAGCATAAACTCCCAAATTAGCGTCAAGAACTCGCAAAAATGCTGCACATAATAGCCCAATGCACCTTGGTGAAGAGGTCTCCGTACACGACGTAGAA
GCTCTTTGCGTCCGAGCCAAAGCCCGAATACACCGACGCGCTGAAGTACCGGAACAAGTTGAGCTCGTCCTCGTCTTCGTCCTCATCGTTGCCATCTCCG
CCGCGCAGAATCTGCTCGCGGTGCTCGTCGTACCATTTCTTCTCGTGCGGGTCGCTCAGCACCTCGTACGCGTTCTGGATGGTCTGGAATTGCTCTGTGG
CCTCCTCGCTTGAGATGCCATTCCGCTGGTGCTTGTCCGGGTGCCACCGCAGCGCCTGCAGACGAAACGCCTTCTTGATCTCCACCGCCGACGCATCGCG
CGCGACCGCCAGCACCTCGTAGTGACAGCGCATTGC