Description :
From Genome Similarity Track
Location :
Scaffold_218:15824- 18976
Transcript NameFunction/comments
Phypl_g5443hypothetical protein

Sequence
3152 bases(100 bases per row)
TTAGTACTATGGCCAGTACTAATTTCAGAGAAGGTTGGGGCAATCTTCAACCCATGTGCGGTCCCTAAAAGGCGCGCGCAATGGGTGGCGTTCCCGCCTT
CTCCAGTGCCCCCTTCTTAGTTTTGGCTCATTCTCCAATCTTCCTCGTGTCCGTCACAACGATGAAGTGCGCAAAGGTCGACTGCTGTGTGNCATCTTCC
TCGTGTCCGTCACAACGATGAAGTGCGCAAAGGTCGACTGCTGTTTTGAAGACGTGAAGGAGACGTCTTCCTGCTTTGTTTGCGGGCGTCAGGTACATCA
CctgtgcagcaacgagctgtacGCCGAGGCAGAGCTGTCGAAGAGGTGGTGCTTTAAGACGTAAACGTGGCGGGAAATTCCATTGCAGCACTAACACGAT
GGTCACACAGGTTTTGCAGCCACGACTGTGTCAGCAGATATATCGGCAACACCGACGAATCACAAGAACTAAccccaagcagcacgtcaGGCATCTCAGA
TTCTAGCCAGGCCACAGCCATCTGTCTGCCTCAATCAGAGCTGGCGGAAATGCCTGCGTCGTTGGACGAAAAGCCAGCGCCGCTGTACAGAATTCCAGAT
TCGATCGTTCATCGCGTTCTTGCGAACTCTACCGATTTAATCTGGACTGTGGTGCATGAACTGGAGACGGCGGTGAAGTATCGTAAGAAAACTTACACTC
ACATCTGCCTTATCTGTGCGGAGACAAAGCCGTGGAAGAAGTCGCTCCGCAAGGCAGCACACGCATCAAATGCAAAGTCACACGTGTTACTCTGCCATAA
AGATCACGGCATGGCTGCAAAGGAGCGTGCTCATCGTAAGAAGCTGTCGGACCGGTTCTTGGTAGACGATACTGGTAAGCACGAAGCTCACTCTGAGGAA
GCGGATGAGAAGCAGCTGAGGAAACGCCAGAAGACGTGGtagaagccgaagccgcagcaggaCTTCATCACGGGGCACATCGCTCGCTGGTTGATTCGGG
ATGGTACGTTTCGCTATGTCAGGGACATGTGTGTCGGTGTACATGTGCTAACAGATGTGCATTGTGTACTGTACAATATGGCGACGACATCGGCCTTCGA
GAACTTGTCATTGCATTGACTGGGAACTCCAACGTTACCATACCGGCTGCACAGACGTACAATGACATCCGGGACAATCATTACGACAAGTTTGTGAGGG
AGACAAGCGCGTTTCTGCGTGAGGAACATGAACTGCTGCATGGGACACCGTTCCTAAACGTAATGCATGACTTCTGGACCAACAGTTCGAATGACTATAT
CCTGGGTTCATCCACAGCTTTCCTTGACCATAACTGGAAGCCTCGCCATCTGGCGCTACTTGCGGCGACTAAAAATGACGGTCATAGCTCGGTCGATGTG
GCGCAGCTAATTGATGAAGAGCTGAACACATTGTATGGACTAGACATGGACAAAAAGGTGCGCTTCACGATTTCTGACACTACACCGGTAGCTCGCAAGA
TTTCAAAGCAATTCGATACAACGCTGCAGACCGATTGCGCTATGCACGCACTAAATCTTTGTCTTGGATATGGAATTGACCTCAAGGAAAGTGTGTGGAC
TGTCTATTCAACTAACCCTGTGACGAAGGTGAATGTCAAGAGGAAAGTGGTGATGACGGAAGGTGGAGCCTTCCCTGAAGGTAGTGCAGTAATCCGGAAA
TTACGAGCCCTAAACAACTATTTTGCCTCCAGCAAATCGCCTCAACGTGTTGCGCGTCTGGATGCTGTTCAACGCTTTCTCAAGGTTCCGTATCTAGCAG
TTATTATTGACGTCGATGTTCGTGTCGCATCGGTCATTAAGTTGCTGCAGAGATCTATCATAAACCACCCCGCCTTCCGATCGCACTTCCAGAGTGGAAA
CGCTGCAGCTACCGAGAAGGATGTTTTCAATTGTATATCAGCTGCAGACTGGGAACTGGCTGTGGAAATGGAGGCGATAATGCAACGAGTCGCCGGTCTT
GCGCTCGTCGAGTCCCAATCAGCAAATCTACTTTTGTCGACCATGTATGTCTTCTTGAGGGTAGCATCGGCGCGGGTGAATTCGTACAATTTCCCTGCGT
ATTGTCTCGATGGAACCCGCGACGAGGATACTAATGAAAAGAATTTTGCACGAGTCGAGGTTAAACTCGTGGATATTTCTGATTTGGGACACCGTTGTAT
CAAGCGCACGCTCCATCAAATCGCCACTAGGCTTCCGCAGCCCTATGTTCAGATGGGTATGACGTTGCTACTAGACCCACGGACGAAACGGGGCGCGAAA
AACTATCTCTGACTTCCCGACACAGCGGAAGCCGCCACTGACAAAATCCTAGAGCAAACAATGGAGTTGCTGCGCAAAGAACACCGCGTGTTCTACAAAG
CAATGAACTCTGACGCCACTCCCGAGGACTGTACGGTGGATTCAGCTTCTATTTCGCCTGGTGGGGAGTGTATGTCGGCGTTGGATAGTGAATTGGAGTT
ATTGTGCGGAGATGAGGTATCATAACAGGCAGAACAGAGCCCCATCGATGAAGTATTGAACGAAGCGGCAGATGCATTGATTAAGAAATGGTTAAACCAC
CGCATTGGATGGGCAGACGTCGCGCAGGAACAGTACaccaacgaagaagaacacaATACAATATATGAGAGGCTGAGTATGCGCAACCGACACGGCCAAA
AGGTCTGGAACGTTGAGCAGCTGTGTCAGCACATTAACGTTTGCCGGTGGTTTGCAGAGTGTGGAGATAAATTGTATCCGTCGATCGCAAAGCTTGCGAG
GGTTTGGCTGgggcgcagctcgtccacggctTTCCAGGAGCGTGTCTTTTCAACAGGATCTTTCGTAATGAGCCCGCTGCGGACTCGCACGGACAATGAG
AGAACGCAACGtcagctcgtgctgcgccaaaATCGCTCCGAGATCCAGCGCATGGAGGAGAGTAAGCGAGGTATGTGGTAAGGTAATGTTCACCGTTAGT
CTTAGTCTTAGTAGTCAACTAGTAGTGCTACTAGTAATAGTACTAACACTTGCTTCTCCAATTAGTAGGGCTAAGACTAACTGCCTTACAAAGAGAGAGG
CAGAATTAGTAATAGTACTAACCGAGAAAAATCACCACTACTACCGATCCCT