Description :
From Genome Similarity Track
Location :
Scaffold_558:15821- 19610
Transcript NameFunction/comments
Phypl_g9386hypothetical protein PHYSODRAFT_314852
Phypl_g9387ATP-binding Cassette (ABC) Superfamily

Sequence
3789 bases(100 bases per row)
AAGTCCAACGTCCTTGGCAATTGGCACATGCTTGTCACAAGCAGGGAGCTGTAACTCTGCACTATTGAGGTGGCACAGATCGGAGCTGAGACTTGCGAGT
ACACTACGCATTGAACATGCGGAGGTCTCACGTGAAGTCCGGACTGGAAATGGATCAGAGAACGACGAGAACTTGTACGTTGAGACCGTGAGAGAGGAGT
GAACTTGGAGAGGTTGGCCGTCTCTCTGCTTTCGCTTGGACGCTAAAGTCAACAGATCTCCACGAAGCGAACCACGTAGTCGATCCCATGTGTTCCCACA
GCAGACTGGTCGAGCAGGGGGCGGTGGATCTCGTCTTCCTTGTTGATGTGGGCTTTCAACAAACGCGAAGCCAGCGATACGAAGGTCCCTAGACGAGATT
TTTTGTCAAAATAACCAAGCAGGAATCAACGATGAAGGGGAATGCAACTCCGTGGACGCTTGCTAGCATCCGCAAAGTACAAGGTCTTATGAAAAGTCCG
GGCTGCCCATGAAACTAGCACCAGAAACCTTAACGTCGAGCGAGCCCTTCAGGGGCAGAGTTAACGACACGTCGAACGTCACCTTCTCCGGGTCCTGCAC
TTCGATGTGAAACTTGTTCAACAGCCCTGCCACGACCAGCTTCATCTCGAGCATGGCCAGGTTCATTCCAAGACACAAACGAGGACCGACGTTGAATGAC
GCAAACTTGTAGGAGGACACGCTGACCAACTTTCCAGTCGCAGAGTCGATCCATCGCTCGGGTTTGAATTCTGCGGCATCGGCCCCCCACACTCGTTGCA
TCCGCGCCATCGCGTACGTTGCCAGAACTATCATGGTGTCCCCCTTGACGAAAGTTCCGTAGTGTCCTCCACCACGTACTTCAGGACCATCGGAACGGGT
GGGTGCAAGCGGAGCGTCTCCTTCAACGCAGCTTCCAGATACACGAGCTCGCTCACGTCTTGCATCGCCGAATTGGTAGCAGCAGTCGCCTCGCCCCCAG
CCTTGTGGAGTCTCTCGGCGATTTCGCTTCGAATTCTTCTCTCGACACGAGGGTTCTTGGTGAGGTTGAGGAAGAACCAGCTGAGCGTTTGAGCCGTCGA
GTCTCGTCCAGCGATGAGGAAATTCACCACGATGTCGCGCAGGTACATGGGGTCAAACTGCCGAGTGCCAGCACTTGGTGAGCTACCGACACTGCCCAGG
AAGAGGGAGACAATGTCCCTCCCTGCGACGGTGACACCGTCATCttcaccgtcgtcgccacGCCTTGCTAgggcctcctccacgatgTCCAGCACCGTGG
CATTGATCACGTCCATgtcgtgcttgagctcgccTTCCACACCCACTCCCAGCCACCGCTGAGTCTTCCAGAACCAGCCCGGACGTACGAAGCGCAAGAG
CAGCGCTCTCTGCGCATGATCAAATGTCTTCTGGAACGGGTGCTCCTCATCCGAGCCCAGACAGCTCATGTGCACGCCGAAGACAATCTCTGCGAAGGCC
TCGATCGTAAACCGATTGAAAAGCTTGAACAAGTCGAGCGTGTCACCAGAGTCACTTGCGCGCTGCATTATGTCGTAAAGTACAAGagcgtggcgctgga
tcgTGGCTGTCATGGAGTCTCGTAGAGCCCTCATGGTGAAGAGGTTGCTAGCCATCTTGCGTTGGTGCACCCACTGCCCCCCGTCAGCAGCGAAGATCCC
GTCGCCAAGGAGATCCCTCAGGTTCTCACGCATGTAGGAACCTTTGGGAAAGTTGCTGAATTGGGTCTTGAGGACATCTTCGAACGCCTCGGGGCTGGAG
accacgaactcgtcgggCATACCGATGGAGCGGAAGAGAACGGGCTCTCCGTTGAGCTGAGCGCAGATCTCCGCCGTCCGGTCGTGCATGTCGCCatcgc
gagcagctcgaaggaTATCGAGCGTGTTCTCCAGAAGCGGAAGTGTCGAGTCGGGGCGGTGAACCTTGCGATGCTCCGACTTGGTCGGGTCGTTGTCGTT
TGGTTCGTTGCGAGACTTgaccaggaggaggacggcgacggaggcCAGCACGAGACCCCCCAAGCCGACGGTGACACCGCTGGAAGGGAGTTTCTCCCGG
AGCGAGGCAATCGACAGCATCTTGCGACGCAGAGTTTGAGCGCTAGGTGGCGTCTTGGATTCtgccgagagcgacgccaaCGAGGCTTTTCTGGAGCGGG
CAGCTCAATTAGCTGCCAATCGATGGAAGTTGGACCCGTTctggtgttgcagtcgctcgaACAGAGAAACCCGAGGCGGTCCGACATTGAGCGCACCACC
GGCAAGCTCCTTTCGGCTGGGATATCTGTTTGCTTAGCTCAAATGATCAGCAGCCCCCGTCGCCCGATGTGACGGCATCGCTCAATCTACACATTCGACG
AACTACAGAAACTCGAAATCGTATCCTAGTTACCGGTATTTGCCAACGTAAACAGAACCCTCACTCTTCTGAAATAAAACCATCACTCTTCAGATTATGC
ATCCGAGCTTTTGTGGTCCACCGACTGGACGCGTCAGTTTCCAATCGGCGCCACGGGTGACAAGAGCTTCAACCGTTGATCGAGTCCGTTGACCCCCACG
CGTAACGACTGTCGGATGGCGCCTTCCAAGCCAGAGGAGcgcaagccgctgctgcagggcgtgACGGTCgtgcacgacggcgccgccgcgcccgacAAGC
AGACATGGATGCCCGTGGACGCGCCCGGCCTGGGCGACCGCTACCCGTCGCAGCAGTCCGGCTGCCTGGgcaacgtcttcttctcgtgggTTACGCCCCT
CATGAAGCTGGGCAACGAGCGGCCgctcgagaacgacgacctGTTCCAGCTGGACCCGCACAAccgcgccgccagcgtctcccGGACGTTCGCCGACGCC
TgggcgcagcagacgcgctCCGGCAAGCCCAGCCTCGTCCTTGCGCTGGGCAAGGCCTTCGGCTTGaagttcgtggtggccgGCGTCCTcaagctcgtcc
acgacTCGCTGCAGTTCGTCGGGCCCATGGTCATCAAGGACATCATCGCGTACCTGAGCGACccggcggcgccgcggtCCGAGGGCCTCACGTACgccgc
cgtcatcttcgtcgcgggcgtcgtgcagtccttcgcgctgcgccagTACTTCTTCTACTGCTACGAGACGGGCCTGCAGTTCCgcagcgccatcgtcacG
GCCGTGTTCGAGAAGTCCATGGTGCTGTCGGCCGcggcgcgccagcagcgcacgtCCGGAGAGATCACGAACCTCATGTCCATCGacgcgcagcgcctgc
aggaCATGACGCCGTACCTGCACGCCGTGTGGTACGCGGCCTTCCAGATCATCGTGTCGTGCGTCCTGCTGTGGCAGCAGATCGGCGTGGCCACGTTCGC
CGGCGTGGCGGTCATCCTGCTGATCATCCCGCTGATGACCGTCATCTCGAAGGCcatgcgcaagctgcagcagcgtctgaTGCAGGTCAAGGACGAGCGC
ATCAAGATCTGcgtggaggtgctgtcggGCATCAAGGTGGTGAAGCTCAAGGCGTGGGAGAACTCGTTCGGCCAGCGCGTGATGAAGTtccgcgacgagg
agctggcgcgcctGCGCACGTACGTGTTCGCGCGCAGCGGGTCGAACaccatcttcagcttcgtgcCGTCGCTGGTGACGGTGGTGTCCTTCAGtgcgta
cgtgctgctgggccacacgctggacgtgggcaCGGCCCTGACGAGTCTGGCACTGTTCAACATCCTCCGCTTCCCGTTGTTCATGCTAC