Description :
From Genome Similarity Track
Location :
contig_237:15820- 18444
Transcript NameFunction/comments
g14924.t1hypothetical protein

Sequence
2624 bases(100 bases per row)
AACCCCCCCGCCAAACTCCGAGAAGATCCAGCAACTGTACAACAAAGTGCGTCCGTACGTTCCAGAAGAGTTTGTGAACGATGCACTGTACGCTCCGCCG
AACGACGAAGACGAACGGAAAGCAAACGAGATCAAGAGGGCTCGAGCTGCACGCCAAAAGGCATCCGCCAAGAGAAAGAAGCTTGAAAGAGAAGCAGCAA
CGAAGCGTGATCCACCAAGTGAAGCTGCAGTGAACAGTGCCGGTAATGAAGCCGAGGCAATGCAAACCGAGCAGCAGCCAGCTGAAGGAGATCGCAGTGG
TCGAGACGAAGCATCCATGGCGAAGGAGCCGTCACATGTGAAGAAAAGACCACGTAAGGAAACGTCGTGACTGATGCGATTTCCGAGCCCGGGCAGTGTT
TTGTTCTCGGTAAATCAAAATGATCCATCGCTACCAAAATCCTAAATATACACCTCGATTTTTGATTTTCTGAATTTGGTGCTCATAATACTGCGTCTAA
AACAAAGAAGAAGTCGAATTAGGAGCTCGGAATAGGCGCAACGGCTCCGTTGGTTCAGTTTACCCCCAGTCAATCAATAAAAAAAAATCGAGTTCGGCCA
GATCTCGAGGCAACACATTTTTTCAGAGACCCTCACTCAGCGAAGACTACGTGGATTTTGGTGCTGGGGAGCTCTACGTGTAGCTGAGACTCTCCTCTTT
ACGATGGTGTGCCCAGCTCGTAATTTTCTAAATGGTTAACTAGCATTATTTTGTTTCACGCCGTCTCATATTCGCTACAGCGGATCCTCTCTGGGGTCTT
GATCGGCCGATCTGGGCCTTCACGTCAAGGCAAGTGTTTCTGGCTCTTGCACGGTAAGCATCCGTATCCTCTATGAAGGGTTAACCCTCTCGGGCACAGC
TGCGGTCCCGTCGTCGGTATTGGGTCTTCACGTGTAGAGTAACCAGCTCTTAAACTCCGTGGGGTGCCGTTTCCGCTGTTATTTGGGCTTTATTGAGGTC
TTTCTGCTGGGCCGTCATGTCAAGAGGTTCGTATATGGACTCTGTGTTGCACTCTGGGGAGGGGAAATCGCGAGCGTAGAGGGGTCCCATCTCTTCTGTG
CGTGGTGCTTGAACGAGAACGCGAGGGGCTCACCAGGCCCGAGGTGTCTTGGTGTGTGAGATCTTGAACACGTGGGGATCACCAGGCCCTCCGTGCTTTG
GTGTTTGGGTTGCGTAACCGCGATGGTTCACCCTGTCAACGCGCCGTGGTAGGTGCTTGTCTTGAGCGCTCCTAAGGTTACCAGGTCCTCGGTGCGCCTT
GGCGACGTAATCTTCTTGGGCACTACGGGGCCGCCAGGTCCGTTGCGTCTTGGTGTTGGTCTCGACTTGAGGGCTCGCAGGGGTCACCAGGCCGCGCGCC
CTGAGGCTTATGAATTACTTGGTGGTATTCGCCAGGTGGTGGCCATCACCCTCTAGCGTACGGGGAACAGCTCTTCTTTCCAGCCCCCGCCCCACACGGG
GGGAAGTTCGCGTCCGAGAGAAGGAAGATCCGGTTACCTCGGACACTTGTGCTAAGCGACGCGAATTGCGAACTCGCGCGGGCTTAAACCTAGGATCATG
CATGTTCACACGATGTGGCTCACATCTCGCTCGGTGTATGATTTCCCGCCGCCCTCAGGGTACGTGGGGTGAGGCGTGGGTGTAGATTTCTTGTCGATAG
CTTCGATTTTGTGACAGCCGCTCTGCATTTTTTACCAATGTCCTCTGTCTGGTGATGCGAGCGCAAATTGATGATGCGGCTGTCATGATGATGGAACCAT
GGTGATGTAGTTTTCGATGTCAGCAGCTGGTGTCGGTAACGTACATAGTACACACGTCTCCATTTGAGATATCCTACATGTACCCTGAAGTCGTAGCGTT
GAATATATCGGCAGGAGCAGCGTGTATTTTGCACGAGAGTGCAAATTGGTTGGTGAGCACGCAAGGCTGTCACGCAGTAAGATCGTAGATTAGAAACAGT
CGTTTTAAATTCATGACGAGCCACCACTCCTCAACCCCGGGAAGCCTCTGCTTCGTGGAGTTCGCCGTTAGATTCTACCTCTACCCTCTCAATTCGAGCA
TGGCCACAAAGAGTGTTTGGCAAACACTACTCGGATGACAAGCCTTATAATTGTTGCCGCCGCCGCTGCCGTATGTACCAACACCAGCTACGGGAGCTGA
TGATGTGGAGATGGGTAAACTGAAAATCTCGTGGCGTTCTCTGTATTATACCAGTAATTTATAGTAATATAGAGTGTGTATGGTCATGTCGGTACAGAGC
GCGCCACGAGATTTTCAGTTTACCCATCTGCATTATCTGTGATCGGGTGTACTTCCATTTTTGTAAATACACAATCGCTTATCGTGATTCCAAGCTCCGT
GCACGGAAGCTAGCCGGCATCGTACATGCACAGTAAATGCGACTGCACGATAAATGTATTATTATTAATATACAATATATTTTTAAAATAGCGAGGTCGT
CGCGGATTGCGAGGCCAACGGAGAGCTCTAACGGAGCTGCTGCCATTATGGTATGCGTGAGAATAGGGAAACTAGCGGCATGTATGGAGGGAAGAGACTC
ACTCTCCTTCCTCCATATGCCGGT