Description :
From Genome Similarity Track
Location :
scaffold_236:15819- 18446
Transcript NameFunction/comments
g2535.t1hypothetical protein

Sequence
2627 bases(100 bases per row)
CGCCAAACTCCGAGAAGATCCAGCAACTGTGCAACAAAGTGCGTCCGTACGTTCCAGAAGAGTTTGTAAACGATGCACTGTACGCTCCGCCGAACGACGA
AAACGAACGGAAAGCAAACGAGATCAAGAGGGCTCGAGCTGCACGTCAAAAGGCATCCGCCAAGAGAAAGAAGCTTGAAAGAGAAGCAGCAACGAAGCGT
GATCCACCAAGTGAAGCTGCAGTGAACAGTGCCGGTAATGAAGCCGAGGCAATGCAAACCGAGCAGCAGCCAGCTGAAGGAGATCGCAGTGGTCGAGACG
AAGCATCCATGGCGAAGGAGCCGTCACATGTGAAGAAAAGACCACGTAAGGAAACGTCGTGACTGATGCGATTTCCGAGCCCGGGCAGTGTTTTGTTCTC
GGTAAATCAAAATGATTCTTGTTTCCATCGCTACCAAAATCCTAAATATACACCTCGATTTTTGATTTTCTGAATTTGGTGCTCATAATACTGCGTCTAA
AACAAAGAAGAAATCGAATTAGGAGCTCGGAATAGGCGCAACGGCTCCGTTGGTTCAGTTTACCCCCAGTCAATCAATAAAAAAAAAATCGAGTTCGGCC
AGATCTCGAGGCAACACATTTTTTCAGAGACCCTCACTCAGCGAAGACTGCGTGGATTTTGGTGCTGGGGAGCTCTACGTGTAGCTGAGACTCTCCTCTT
TATGATGGTGTGCCCAGCTCGTAATTTTCTAAATGGTTAACTAGCATTATTTTGTTTCACGCCGTCTCATATTCGCTACAGCGGATCCTCTCTGGGGTCT
TGATCGGCCGATCTGGGTCTTCACGTCAAGGCAAGTGTTTCTGGCTCTTGCACGGTAAGCATCCGTATCCTCTATGAAGGGTTAACCCTCTCAGGCACAG
CTGCGGTCCCGTCGTCGGTATTGGGTCTTCACGTGTAGAGTAACCAGCTCTTAAACTCCGTGGGGTGCCGTTTCCGCTGTTATTTGGGCTTTATTGAGGT
CTTTCTGCTGGGCCGTCATGTCAAGAGGTTCGTATATGGACTCTGTGTTGCACTCTGGGGAGGGGAAATCGCGAGCGTAGAGGGGTCCCATCTCTTCTGT
GCGTGGTGCTTGAACGAGAACGCGAGGGGCTCACCAGGCCCGAGGTGTCTTGGTGTGTGAGATCTTGAACACGTGGGGATCACCAGGCCCTCCGTGCTTT
GGTGTTTGGGTTGCGTAACCGCGATGGTTCACCCTGTCAACGCGCCGTGGTAGGTGCTTGTCTTGAGCGCTCCTAAGGTTACCAGGTCCTCGGTGCGCCT
TGGCGACGTAATCTTCTTGGGCACTACGGGGCCGCCAGGTCCGTTGCGTCTTGGTGTTGGTCTCGACTTGAGGGCTCGCAGGGGTCACCAGGCCGCGCGC
CCTGAGGCTTATGAATTACTTGGTGGTATTCGCCAGGTGGTGGCCATCACCCTCTAGCGTACGGGGAACAGCTCTTCTTTCCAGCCCCCGCCCCACACGG
GGGGAAGTTCGCGTCCGAGAGAAGGAAGATCCGGTTACCCCGACACTTGTGCTAAGCGACGCGAATTGCGAACTCGCGCGGGCTTAAACCTAGGATCATG
CATGTTCACACGATGTGGCTCACATCTCGCTCGGTGTATGATTTCCCGCCGCCCTCAGGGTACGTGGGGTGAGGCGTGGGTGTAGATTTCTTGTCGATAG
CTTCGATTTTGTGACAGCCGCTCTGCATTTTTTACCAATGTCCTCTGTCTGGTGATGCGAGCGCAAATTGATGATGCGGCTGTCATGATGATGGAACCAT
GGTGATGTAGTTTTCGATGTCAGCAGCTGGTGTCGGTAACGTACATAGTACACACGTCTCCATTTGAGATATCCTACATGTACCCTGAAGTCGTAGCGTT
GAATATATCGGCAGGAGCAGCGTGTATTTTGCACGAGAGTGCAAATTGGTTGGTGAGCACGCAAGGCTGTCACGCAGTAAGATCGTAGATTAGAAACAGT
CGTTTTAAATTCATGACGAGCCACCACTCCTCAACCCCGGGAAGCCTCTGCTTCGTGGAGTTCGCCGTTAGATTCTACCTCTACCCTCTCAATTCGAGCA
TGGCCACAAAGAGTGTTTGGCAAACACTACTCGGATGACAAGCCTTATAATTGTTGCCGCCGCCGCTGCCGTATGTACCAACACCAGCTACGGGAGCTGA
TGATGTGGAGATGGGTAAACTGAAAATCTCGTGGCGTTCTCTGTATTATACCAGTAATTTATAGTAATATAGAGTGTGTATGGTCATGTCGGTACAGAGC
GCGCCACGAGATTTTCAGTTTACCCATCTGCATTATCTGTGATCGGGTGTACTTCCATTTTTGTAAATACACAATCGCTTATCGTGATTCCAAGCTCCGT
GCACGGACAGCTAGCCGGCATCGTACATGCACAGTAAATGCGACTGCACGATAAATGTATTATTATAATATACAATATATTTTTAAAATAGCGAGGTCGT
CGCGGATTGCGAGGCCAACGGAGAGCTCTAACGGAGGCTGCTGCCATTATGGTATGCGTGAGAATAGGGAAACTAGCGGCATGTATGGAGGAGAAGAGAC
TCACTCTCCTTCCTCCATATGCCCGGT