Description :
From Genome Similarity Track
Location :
contig_237:15818- 18442
Sequence
2624 bases(100 bases per row)
ACCCCCCCGCCAAACTCCGAGAAGATCCAGCAACTGTACAACAAAGTGCGTCCGTACGTTCCAGAAGAGTTTGTGAACGATGCACTGTACGCTCCGCCGA
ACGACGAAGACGAACGGAAAGCAAACGAGATCAAGAGGGCTCGAGCTGCACGCCAAAAGGCATCCGCCAAGAGAAAGAAGCTTGAAAGAGAAGCAGCAAC
GAAGCGTGATCCACCAAGTGAAGCTGCAGTGAACAGTGCCGGTAATGAAGCCGAGGCAATGCAAACCGAGCAGCAGCCAGCTGAAGGAGATCGCAGTGGT
CGAGACGAAGCATCCATGGCGAAGGAGCCGTCACATGTGAAGAAAAGACCACGTAAGGAAACGTCGTGACTGATGCGATTTCCGAGCCCGGGCAGTGTTT
TGTTCTCGGTAAATCAAAATGATCCATCGCTACCAAAATCCTAAATATACACCTCGATTTTTGATTTTCTGAATTTGGTGCTCATAATACTGCGTCTAAA
ACAAAGAAGAAGTCGAATTAGGAGCTCGGAATAGGCGCAACGGCTCCGTTGGTTCAGTTTACCCCCAGTCAATCAATAAAAAAAAATCGAGTTCGGCCAG
ATCTCGAGGCAACACATTTTTTCAGAGACCCTCACTCAGCGAAGACTACGTGGATTTTGGTGCTGGGGAGCTCTACGTGTAGCTGAGACTCTCCTCTTTA
CGATGGTGTGCCCAGCTCGTAATTTTCTAAATGGTTAACTAGCATTATTTTGTTTCACGCCGTCTCATATTCGCTACAGCGGATCCTCTCTGGGGTCTTG
ATCGGCCGATCTGGGCCTTCACGTCAAGGCAAGTGTTTCTGGCTCTTGCACGGTAAGCATCCGTATCCTCTATGAAGGGTTAACCCTCTCGGGCACAGCT
GCGGTCCCGTCGTCGGTATTGGGTCTTCACGTGTAGAGTAACCAGCTCTTAAACTCCGTGGGGTGCCGTTTCCGCTGTTATTTGGGCTTTATTGAGGTCT
TTCTGCTGGGCCGTCATGTCAAGAGGTTCGTATATGGACTCTGTGTTGCACTCTGGGGAGGGGAAATCGCGAGCGTAGAGGGGTCCCATCTCTTCTGTGC
GTGGTGCTTGAACGAGAACGCGAGGGGCTCACCAGGCCCGAGGTGTCTTGGTGTGTGAGATCTTGAACACGTGGGGATCACCAGGCCCTCCGTGCTTTGG
TGTTTGGGTTGCGTAACCGCGATGGTTCACCCTGTCAACGCGCCGTGGTAGGTGCTTGTCTTGAGCGCTCCTAAGGTTACCAGGTCCTCGGTGCGCCTTG
GCGACGTAATCTTCTTGGGCACTACGGGGCCGCCAGGTCCGTTGCGTCTTGGTGTTGGTCTCGACTTGAGGGCTCGCAGGGGTCACCAGGCCGCGCGCCC
TGAGGCTTATGAATTACTTGGTGGTATTCGCCAGGTGGTGGCCATCACCCTCTAGCGTACGGGGAACAGCTCTTCTTTCCAGCCCCCGCCCCACACGGGG
GGAAGTTCGCGTCCGAGAGAAGGAAGATCCGGTTACCTCGGACACTTGTGCTAAGCGACGCGAATTGCGAACTCGCGCGGGCTTAAACCTAGGATCATGC
ATGTTCACACGATGTGGCTCACATCTCGCTCGGTGTATGATTTCCCGCCGCCCTCAGGGTACGTGGGGTGAGGCGTGGGTGTAGATTTCTTGTCGATAGC
TTCGATTTTGTGACAGCCGCTCTGCATTTTTTACCAATGTCCTCTGTCTGGTGATGCGAGCGCAAATTGATGATGCGGCTGTCATGATGATGGAACCATG
GTGATGTAGTTTTCGATGTCAGCAGCTGGTGTCGGTAACGTACATAGTACACACGTCTCCATTTGAGATATCCTACATGTACCCTGAAGTCGTAGCGTTG
AATATATCGGCAGGAGCAGCGTGTATTTTGCACGAGAGTGCAAATTGGTTGGTGAGCACGCAAGGCTGTCACGCAGTAAGATCGTAGATTAGAAACAGTC
GTTTTAAATTCATGACGAGCCACCACTCCTCAACCCCGGGAAGCCTCTGCTTCGTGGAGTTCGCCGTTAGATTCTACCTCTACCCTCTCAATTCGAGCAT
GGCCACAAAGAGTGTTTGGCAAACACTACTCGGATGACAAGCCTTATAATTGTTGCCGCCGCCGCTGCCGTATGTACCAACACCAGCTACGGGAGCTGAT
GATGTGGAGATGGGTAAACTGAAAATCTCGTGGCGTTCTCTGTATTATACCAGTAATTTATAGTAATATAGAGTGTGTATGGTCATGTCGGTACAGAGCG
CGCCACGAGATTTTCAGTTTACCCATCTGCATTATCTGTGATCGGGTGTACTTCCATTTTTGTAAATACACAATCGCTTATCGTGATTCCAAGCTCCGTG
CACGGACAGCTAGCCGGCATCGTACATGCACAGTAAATGCGACTGCACGATAAATGTATTATTATTAATATACAATATATTTTTAAAATAGCGAGGTCGT
CGCGGATTGCGAGGCCAACGGAGAGCTCTAACGGAGCTGCTGCCATTATGGTATGCGTGAGAATAGGGAAACTAGCGGCATGTATGGAGGGAAGAGACTC
ACTCTCCTTCCTCCATATGCCGGT