Description :
From Genome Similarity Track
Location :
Scaffold_604:15817- 17305
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_604-snap-gene-0.9Cryptochrome

Sequence
1488 bases(100 bases per row)
GGAAAAACAAACACGATATGTACGGAAGAGCATGATGTATTGTATTCGTGGATGATCATTTATTTTTCCTGTGTCACACACTCTTGCATAAAGGGTGCCA
CCATGAGTTGGTTAGCGACTTTGTCGTTGATGAAAGCGAAGGAGGTACGTGGGTGTGATCGTCATTTGATATCACTTTTTTCCAGTGGAGACCGTGTCAA
CTGAGGCGTGCATACGGATACACACGTGTAATGAAGGACGATGCATTGCGAAAGTGCCACGTTCCGTTCGCTTAGAGGGTGCCTGCGCGAAGTGCATGGG
TTCAAGTTGTTGGGAGATAAAAGAAATCAATCGTCATTATTCTTGTTCTCTTAACCCGAAGAGGTATCTTCCCAGCACAACGGAAATGGGACGTTGACGC
ATCCGGCGAACGCGAGAGATTCGCGGCTGTGCTTGCGTGCGCTTTCTTGTGTCTTGTCTGCAGATGTGTGTGTGTGTGTGTGTGCTAGGGATGCTGTTAA
TGGGAGATCAAGACAATTGTCATGTATTAGTGGTTGCGCTTGATCCCTTCCGTCGCTTGAGACACGGGTGAGCATAATGTCTAGGCTTGCATCAATCAGT
GGCGTGTGTGCTACATTCGGTAGGAGATACAAGAAGTATCATTTTATTGCTCCTTACTTCAAAAAATTCGGTTGAGATGCGTTTAGAGCTGGATGGCTAC
GTGCATGTATGTCAGCCAATATTATGATACACTTTTCCGAGTCCAAGCGAGTGTTGTGTTACAGTTCAACGAGTCGTCATCCGTTACCTGCCTCCCAGCA
CAACAACCTATATAAATACATACTATAGGGAATGAGTTTGTATTAAAAATTGAAACCTTTGAGCTATAACCCAATCTATTTTGACTATTAATATCGTTGA
AAAGTTGAAAGAACAATGTGAATCTGATGGGGTAGGGAGACTCCTCCAAAAGTACCAACACAAGCACAAAGAAACGAAACATACGTTCGCGAACACGAAC
GAAGGGCGACGAAGCTTTTGTTGTTGCTTTGGGCTCCAAGTGTGTGGTACAAGTCCAAACTTTTTTTAAAAAAATATGAAACAAAACAAAAAAAAGGCAG
AAAAGAAATACACATGCAGCCAAATGGTTCTCAGGGGTAGGTCTTCTCTTACTCACTCAGCTGATTGGATGGTTGCGGCCAGCACAAATAACAACAAAAG
CGCTCGTCGTGGTCAGCGACGGGGAGTGGAGCGGATTTGTATTTTTTTTTTGATTTCCTCCAATCGCGTTCTGTTTACCGATGTCCCTTTTTCCTCCAAT
CGTGGGCCAGCATTCTGCGCAATGCAACCCCTGCCATATGATCTTTGCAGCCAAAGAAGCGTAGCGAACGCCATGGAAGACGACGCGCTGCTCGCGGATC
TCACTCCGTTCGCGCTCAGTGACGAGGAGGAGGCTGGGGCGCATCCGCGGGTCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN