Description :
From Genome Similarity Track
Location :
Scaffold_15:158147- 159329
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_05181FOG: GGDEF domain

Sequence
1182 bases(100 bases per row)
TTCGAGTCGTACGACGGCGTCGGTGCGCAGTACGGTCTGCGCGCCAAGCCCGACACGTACAAGCTTGCATGGTTTGAGCCGAGCGCGTTTATCATTACGC
CGTCGCCCGACGGCCACAAGTCGATCGTGACGCTCACGTTGGCGTGCCGAAAAGCCGGTGGCAGCAACCTCGTGAGCGCAGCGCTGACCAAGCTCGCGAC
GCGGTTCGCGCAGGCCTACGCGCACCTCGGCGACTGCGGCTCGACGCAGTCGCTTGTCGAGCGCTCCAACTATATGCAATCCTTCCACCGTACACCGTCC
TCGGCGTCCACGACCCGCAGCTTTGTTGAACAACCCGACCGCCGACAAAGCGCCGACCGCCAACAAAGCGCCGACCGCCACAGCCCCGACCGCCGGCCGA
GTGCAGACCGCCACAGCCCCGACCGCCCGGCCCACCGGTCCAGCGGTGGCAGCCACCACAGCCACGAGACCGCGCGCGGGTCAGGTCGGTCGGACAGCTC
GGCGGACGACGTGCCGCGACCCCACAAGAAGGCGTCGAAGCGTCAGACGTTTGTCAACGAAGACTTTGCCGAGATTTGCCGGACTGCGATGCAGAGCCTC
GACTGTCCGATGGCCGGCATCCGCACGACGCTCTTCGAGATCGTCCAGTATGCGCCGACGGCCGACATGAGTCGCATGCCCAAGTCGCTCCCGACCTTTC
GGCGCATGGCGCAAACGGGCAAGCCCTGCGTCGTCCTCGACGTGCTCTCGGACAAGCGCATCAGCGACGAGAAGCGGTCCATCTCGCGCGTCCAGTTCTT
TGTCGGCGTGCCCATGGTGCTCGAGAGCGGCGAGTGCATTGGCGACGTGTGCGTCGCCGACGTCAAGCCGCGCAAGGTCATCGATTACACGCAGCTCGAG
ATTCTCAAAGTCCTCGCGCAGTCGGCGACTGCGTACATGACGAGCGCCGAGTACCTCGCCGAGACCACCGACCTGCCGCGCGACGAAGATGTCGGAGACC
GCCAACCGTATACAAACACCACGATGACGTCGTCGTCGTCATCGACGTCGTTCCACCACCGAGCGTACGAGCACCCGGCCGAGGACATTGCGATCGAGAG
CTTGGGCATCAAGGAAGTCGCCTTTTAATACTATTGATTAATGTGGTGCGCGCTCGCTCGTGAGGAGGATGGACGGGAACGG