Description :
From Genome Similarity Track
Location :
contig_60:158127- 166353
Transcript NameFunction/comments
g9079.t1hypothetical protein
g9080.t1hypothetical protein PHYSODRAFT_466642
g9081.t1hypothetical protein

Sequence
8226 bases(100 bases per row)
TCTGCGCGAACAGAGCCGAGCATTCCATTAGCTCGATCTTCAAAGGACGTAATCGCGCTGATCATGCTGCGCTGGACGTCGCAGCGCCCGCGTCCACGAG
GACGCTGAAGCCTCATTTCTTGCAGCGGGTCGACGGCAGTGCCGCAGACAGCACACACTGCGTGAGGTGGTCGGTCCAACTGCACTGACGAATTCCAGTG
CAACGTGCTTCATGTCGGCCCACTGCTGCGTGCAGCTCGGACAGTGCGTGCGCTGCTGGTGCCCTCGAATCTTCTGCAGCATTTGGTCGCCAGCGGCGCG
AACCATTCGTTCCATCTCGGCTTTGTCCTGTCTCGCCGCGGTAGACTGCGCATAGCTGCTGGTTGCTGTCCGTAGTTGAACAAGACAAGCAGCGAAACGT
TAGTGACCGATATCCAGTGCAAGGCTGCACAGCACAGGAGACGGAATCCGGTGTACCGATGCGTTGCCACTTCTTGAGTTCTGCGACTGCACTGTCCAAG
TCGCGCCGGATATGCTGCATTTGCTGCGTGGTCTGCTCGAGTTGCTGCTGTCGACGCACCAAATCGTTCTGTAGGCGAAACGAACGATTTGAAGTCATGT
GTTGGATTTGGTAGGCACGCTCTAGCTCACATCGCATTTCTCTCAGTCGCTCTGGAATTCGCGAGGCAGTAGTTGTCTGCTGCTCGTTGCGGTTGGAATT
AGGGCGAGTCCGAGGTATGGCTTCACGATCAACCACTGCACCTCCAGACGAAAAGTACAGACGCACTATTTTCTTAGCTCCGCGCCGGCAAACAGGACAA
ACTCGTTTGCTTGCTAGAGCTTGTTCCGCACACGTGTGATGAAAAACATGGCCGCAAGCCAATGCTGCCAAGTGTATCTGCAAGCTTTCTAGGCATATAG
CACACTCGGTGGACGCTTGATCTCTTTCTCCGTTCTCGCTCTTGGGCATTGGTGGGGGTGATCTTTGTTGCTCGTACGAAGATGGTGAGCCAGGAAGTCG
ATACGACATGCTTTGTGAATGGGAACTTCTGAGTGGTCTCATTCCTTGCCAGCGCTTCGATGGGAGTAGACGCAAGAATACAGCAACGTAGCTTGCGTCG
TGTCCCTGTTGGGCTTCTTCAACGAACATCTTTCAAATGGCGATACTAGTATTGTACTTTTTTGAGTTCTATGTATACTATCTCTGCGTTCAGGCTGCAG
GAACAGGTCTGCCTAGATATGCAGCATAGCTGCGATGTAGGACGCGCTGGGGCGTAGTGACGGATCGTATTGCAAGCATGCGACTGCCAGCTCTCGGACC
ATCGTGGGACATTCAGGTGTGAACGTGAACATGCCCATAAAACTCGTGTCATCGTTGTTGTGTGCGCCGAGCAGAGGAGTGGTCCGTCGGCGGTTTTCCT
CCAGCCCAACACTGCGCGAGCTTTGCAGCGTACGCGAGCTGTTAGAGCTTGGCAGGCTCTCCAGCTGGGTGGTACGTCGTCGTGAGCTGTCCGAGTCACT
GCCAATGTTAGTTGATACAACCGTGCCGTCCGTAGAGAGGAGAGTGCCGTTGTCCGTGTCGAAGTCACCAATGTGCGTACGCATCCTCCACGAACTTCTG
ATCATTTCGTCTGCTGTCTGGCAAGTGTCCAGGTGTGCAAGCAGCACGCCGAACGCGTACATGTCCGAGGACGACCGAGACGGCTCGCCGATGAGGATTT
CAGGAGCGAAGAACGCCTTCATGGTGGAATCGCAGCTTTGATAGAATGACTGACAACTGTAGGGGGATGATCCATCAGTGGGAAGAGCAGCCTGCACCGG
GTTTAACTTGCAGCCCTTTTTAGGGTCTACAAACACGCTTCGGCCATTGAGCCCGTCGTACGTAACCATGTGCTGGCTGTGCAGGTACATGAGGCCACGC
GCGATCTCGGATGCTGCTTTCATCTTGAAGTTCTTCCAGTTCAGCTCTGAACCAGAACTCCTCAGGTATGCTTCAAGCGTTCCAAGCGTCATGTACTCGC
AAACTGCTGTCATCGCATGTCTTTCGTCCCACACCAGTCCAGTGATCGAAAGCAATTGCGGGTGACGCATTTGCGAGAGTGTTGGCACCATGTCTAAGGC
CGCCTCCACATCGTCATCGCTGGTCTGGAGTTTAGTCACAAGAACCAAACGCGTGCAGTGTTCGGCAAGCGCAACGGTAATAGGGCCCGACATTGACAAC
TGATTCAACATGACGACATCGGTGGACAGGATCTCCTTGAACGCCGCCTTGCGTAGTCCACCACCGGTGTGGAACTCATTAAGTGAAGCCTCAAGCTCAG
TGGTCTGCATAGTGCTATTTGATAGCACACCCATCCGAGATCGAAGGCTCCGCAAATTCGACTTGATCTTGCTATCACCAGATACCAGCGAATCGTGCTG
CTGCAGTGCTGTCTTTTGTTTATACTTTCGCAGGAAAACAACACCCGACCACGGCCAACACCACGAAAAGCGCAAGCCCCAGAACGACGAACAGAACAGC
GGAGCTATCTTTGCTCTCGGTTGCAGTGGATGTTGTACTTTCCTCTTCGGAACCGGAGCTGTTGATACTGCCGAGACCGTCACCATTTGTGTAGCACACG
CTTTTGTCCGCCAGGATACGGCTTCATAACCAGTGGAACAGCTTCCGGTGACTGTCAAATTGGCTTCAAACACGGGCAGATCCTGCAAATATTGAAGCTG
TGGGTGGGTGACGTGGGCGTCCGTGATAGCGTTGCCTTGTAGATATAAAGCTGACAGGTTGCGCATTTCATAAATAATGGTTGGGATATCCGACAGCTCG
TTGTCACGAAGGTCTCTGTAGAAACAAAGGCTGTCGTTAGTATACCATCCCACATCTCATTATGAAACCGCACGTACAAGGTTGACACAGACGTGAACGC
ATGCTCGCCACGTGGATCAAATTGAGTGAGCTTTGACCGCTGAATAATACTGTGCATGAAACGAGATAAACTCCAGTCAGTTGACGCTGGCTGGGTAGCC
GAATGCGGGTGTGTAAATATCAACATACAGAGACTGAAGACTGTCCGGGAAGACGTTTGTGAGAATTTCATCGATATGAACATCAGAAATGGTTCTGTAG
GAATAACAACACAAAGACTGTCAGTACAAAAGTTCATCCAGATAGCGTATCAATCGCAGCTAAGCACACACATTTGCTGCAGCGCAGTGCCACTCCGGAA
AGCGTCCGACGAAAAAAGAGCGGGACTGCGATCTGCGAGTTTGTCGTCGCGGTCACGATTGTCCTACAAATTACAACAAGACACCGGAAAATCAACGTTA
GCAAATACGGCACGCATTCTTTCCAGGGAGCAATCGCCACGTACAAATTCTGCAAGCTCGACGGCAGCTCGAGGTCGTCGATGGCTTGAAACACGGCCGT
GTTGGCCTTGTCGCTTTGTGGCTGGGCGATCGTCAGCGTCCACTGCGGCATGCTCCAGCTTTCTGGCGTGTCCACCAGACACTGCACCTCACACTTGCCA
GACGTGACGTCCGTCTTGCACGTGGCATGTTGGCATACGCACAGCCCCGGTAGAAAAAGTTTCCGTCATTGTTGTTGTTCTCCTTGCTCCTGTCCCCAGT
TGTCGACGCGTAGTTGACACAGAGCGAAGAGCTGCAGGCTCCGTAGCAGTTGCTCGTGAGCGTGTTGCTCTCCGGAGGGGCACAGGCCTCGTCCGCTGCA
GCGACTGCCACGGCCAGAGCTGCTGCAAACGCTCGGACGCTCCACATTTCTCGCTTGATTCTGCTGGCTTCGCTAGAAAAACACTGGACGCTTGCTCCCA
AGCGAACGCTGCGGCTGCTGAGCCCTCGGACCTGGAATGGGCAAGGCACACACGAGTGTTGCGCGACAGCAACTGGCACGAACTCCACAGGACAAATGGT
GCTGTGAGTCGCTCCACGGAAATGTCTCACTGAATTGTGCATAGCCAGGAGGTAAAGCCAGTCGGATTTCACCTGTTCAATTGGTCAAAAAGCGGGTCTG
ATAATTGTTCTGGTTGGTGGAAAAAGGGAAACCCCGTAACGGCGATTTTGACTTGGGTTTACTATGGCGATCGTTTTTCGCCGTTTTTCGATGGTGGTCG
AAATTCAACGTTCACCTTTCCACCTTTTCTTGCTGGTTGTTCCTGGTGTTGATGGGGACGTCGAGTGCATGCTGGGCGCTGTCTCTAGTTGCTCAATTGA
AGATGCCGCGATCGATCTTTGAGTAGAGTCGATACTCTTTCGTGCGGTTGAACTCGCAGTCGTTACCACGGGCCTTTCCGAAAGACCTTTCGTGGCCGCA
GGGTGAACACGACCACGCCAAGTAATTGTTGCTGCTGCTCGCCGCAGCGCAGCCTCACTGCAGCAGGCCAAAGTGCGACTGTATGTGCATGTACTAATAC
CGATGGCATCTCAGCAATATTGGACACACGATCGGATCGAACGTGAAGTCCATTTACACCTGGCTGTGGTCGTGTGGCTGGGAAGCGAGAGGTGCGTCTG
GGCGGTGCGGCTGTCGTCAGGCCTTTTTGACGAAGTTCGAGCAATCGTGGCCGTGACCATCTCGAAGCTGACCAAATGACCACCGTCATTTCGCTGATTT
GGTCGATAGGCGTGACATGTATCTGTACAATCGCATGCTCGTGGATCGCCCCCAAAGTACATAAAAAAAAAAAACCAATACTTCATTCGTACACCAACCG
AGGCGTGTCCTAATATAGGACGGATTCTACTTCCGGACGGGTTCTATTTTCCAAAACGGTTGTCAACGTCCGTCACCAAGAGCTCAAATTAGACGTGCTC
CGCTATTTACAACTGCGACAGGTGATCTCCACGCCTGACCGACAGCGACGAGGGGGGAGTGATCAAGCAGTCTGTTCAACGAAGCCGTATTCCAAACCCC
ATGAGCGCGCGAAGGTTGCGCGAAGCGACCAAGATTACACCTCGCAGTGCCGTCGGTGCGCCGCTGCCTTGCTATATTGCCACCAAATCCTCAGTCCATC
TGAATAATACATTCTCTTGATGTGCAGGTACCCCGCACAAAGCTGCTGAAACTGAGCACGAGTATTTGCGACGATGTGTGGACCCGGTCCTGATGCCCCT
TATCGAGTCGTTGCTGCTGTATCAGCCGGAGAGCGTCTTCCACTTCATCCTCGACTTTGTGGACGAGCAGAAGGCCGGTCGCTTTACGCACCACCCGCAA
AGCGTAGGTTACGCGAAGAAGCTCACAAACCGCCGTAAAATGGTGGATTTCATGTCCACCAGCGTGATCCCCGTCATGGACGATCTAGCCAAACAGATTC
TCCGCGAGAAGCCAAACTCCGTGAAAGGTGCGTCGTGGCCATTTTTACTACGTACTTGTGTTTGACTTTTAACGCTGACCTGTCCCTCGCGTGAAGCTTT
CATTAAGGACGTGGTTGCTGCGCGTATAGTTATCGAGTCCAGCGAAAGCCCCGAAGAAGCATCAAATCAGCTTGAAGCCCATGTTTACTTCCGCATAAAT
GACCGTGTATTATGTCGGTATAAGGGTCGACCACGCTTCTTTCCAGGTATCATCACTGCAACCGATGACAATGGCAGCTTTACAATCTTATACGACGACG
GAAAGACAGAGAGCAATGTCCACTACATGTGCCTGAGACTGCACCCGACACCGAACTCCAGCGAGACGGCGGCAACACACAAAATGGTTGATGGAGAAGT
TGAGGACAATCAGGAAAAGCCGAAGGCCAGTCGCAAAATGGAGATTGTGCTTTTGATAATTGGTATCGACGGAGCTGGGAAGACTACGCTCCTTTCCACG
TTGCAGGGTGATCTCGACAAGGAGCATGTGCCCAGTGCAGGCTTCACGTCTGCCAAATTTCAGACTGAGACAGGATCTGCTACATTCTACGACCTCGGAG
GCGGCCCAGCGTTCCGCAACGTCTGGAAAGAATACTACGCTGACGTACGCAACTTGGATGTTGATGTCCTAAATTGATATTAACTGTCACATGTTGCGTC
TTGCCCAGGCTCACGGCATCGTTTTTGTAGTCGACTCGTCAAGCGAAAATTCAGTGCTCCAGGCTGCTAATGTGCTCGAAGAATCGATGGCGAACGATCT
CATGACCAACAAACCTTTGCTAATGTACGTGCAGCTCTGGGCTCAATGAAAGGCTACGTAATCCCATGCATTAATGAACAACTTGCGTGCATCATACAGC
TTTGCCAACAAACGCGACCACTCCAACGCCGTAGGAGAGCAGGAGATGCAACGTTTACTGCATCTGAACAAGTTTCCCGGCTCTAAGATTGTACCCTGCG
TTACCAAGCCAGCCGTCAACGGTGGAGCGGTAGACGAGCGCTTGGAGACCGGTCTTGAGTGGCTCTTTGAACAAGTTCACAATGACTTTGACACACTACA
CGAACGGGTTCAGCGCGATCTAGCACTAAAGAAAAAGCAAGACCAGCAACGGCGAGAGGAGCAACGGGCTCGAGTTTCGCGTTGGAAAGAAGAGCGTGAA
CTTAACCAAATGCGTACTTTTGACAAGCCGTCCATAGAGGAGCAAACCCCATCGTCGTCGAAAGCTGCAGCGGATAGACCGGAAGAGTCCGTGATATACT
GCTCAAACTGCAGTACAGCGCCAGCAGTAACGAAGTGTGCTGCATCTAAGTGGATGCCTGTATGCGAAGACTGTGCAACAGCTTTGAGAAGTCAGTCCAC
ATAAGGTTGAATCAAGAGATGCTACACCGCAAAAGCAGCGATTTTGGATTTCAAAGGAGCTCTCTATTCTCTATCTCATCCTCTGCGCTTCTTGCCACCC
TTCTTACCGCGACCTCGCTGCCGCTCTTCGTCTTCTTCTTCCTGTTCTTTCTTTGAGCGCGCGCTGTTCATGATCTTCTCTACATTCTCCTTCTTCTTGC
TTTTTCGCATCTCCTTGCGCTCCCGGCGCTTCTCGGCTGCCTTTTGCTCCTTTTCAAGACGCACACGCTCAGCCTCTTCCTTCTTACGAGCGGCTTCACT
ATCCGCTTCCTGCTGCTCAGCATCAGCACTATTGTCATCATCTTCCGCAGGTGGCTGAGCAGGAACGTCATTTGCATTGTCAACCTCGCGCTTCACCTTA
CCGAGCGCGATAAGCTCCTCCTGCAATACTCGATCCATTTCATCGTCCAAAAGGCTGAGGTCACTAAATACACCAAGTTCCTCCTCTTTCCGCGGTGTTT
CTTCGACGTGAGGTGGTTCTGCAACTGCTTTGTAGACTTGAAGGTCTTGCTGCACAGGTCACACACAAGAACATCCGCGTCCATTTTCTTTCGGAGCTTC
TCAAGTTCCTGCTCAATGTCTCTGTCGGCAACACGGCTGGTCTCCATACCGCTGTCGGCCCACATCTTCTCCTGCTGCTTCTGAAACGCGCGTCGCTCGC
GTCATACGCCGCTTGTTTCTCGCGCTTCTTCGCCTCTTCCTCAATACGCCGCTGCTGCTTCTCCTGCTCCTTTTGCTTCTGAAACGCTCGCACACGCGGG
TCGCGACGGCACACGAAATCCACAAGCTCTCGCACTTCAGTAGTAAATGCCTTCTTGGCCACATCCCGCAGCTTTTTATTCTCCTTCTCCATGGCCCGCC
TCACCAGTCTCGTGGTGCATCGGTCGTTTTGTACTCATCCACCCACGCAAAGCTGCGCTGTGTCGTGTAGCTCTTCCAGTGCTGGTAGAAGTAGTTCACG
TCGTCCATCGACGTCTCAGCGCCTCCGATCTTTGGAGCAGCTGCGGATCTGGAGCCGTCACCTCCCTCCACGTCCAGCTCATCAATCTGTCTCCAGCAGC
ATAAACTCCCAAATGCGTCAAGAACTCGCAAAAATGCTGCACATAATAGCCCAATGCACCTTGGTGAAGAGGTCTCCGTACACGACGTAGAAGCTCTTTG
CGTCCGAGCCAAAGCCCGAATACACCGACGCGCTGAAGTACCGGAACAAGTTGAGCTCGTCCTCGTCTTCGTCCTCATCGTTGCCATCTCCGCCGCGCAG
AATCTGCTCGCGGTGCTCGTCGTACCATTTCTTCGTGCGGGTCGCTCAGCACCTCGTACGCGTTCTGGATGGTCTGGAATTGCTCTGTGGCCTCCTCGCT
TGAGATGCCATTCCGCTGGTGCTTGTCCGGGTGCCACCGCAGCGCCTGCAGACGAAACGCCTTCTTGATCTCCACCGCCGACGCATCGCGCGCGACCGCC
AGCACCTCGTAGTGACAGCGCATTGC