Description :
From Genome Similarity Track
Location :
contig_31:158113- 159987
Transcript NameFunction/comments
g6067.t1hypothetical protein PHYSODRAFT_565187

Sequence
1874 bases(100 bases per row)
ATGGGCAATACTCGTCCAAACACAAAATCAAAAAAAAATTACGCAATTGTTCAGCACTTCTGTCCGCACCTAGATAGCTCTGCTTGGGTCCCATCCTGCT
CCGTCAGCAGGCCGGCTCTTGATTCTTTTAACAGCAACCACCCGACTTCTTCTTGCCACCTCCGTACGGGTCCACGATCTCGGGCAGCGCGTTGCTCTCG
GCCGACGCCGTGGGCAGCGCCTGACTGATCTGGATGAACAGGTCTGACACGTTCGTGTCCTCCTTGGCACTCGTCTCGATAAACAGCGCACCGATCTCTT
CGGCGTAGGCCCGCGCCTGGGACGCCGGCACCTCGCGCTTCTCCTCCAGGTCGCTCTTGTTGCCGGCGATGGCGATCACGATATTGTCCGGTCCGAGCTG
CTTCAGCTCCTTCACCCAGTTCTTGAGCGTCGTCAGCGATTGCTATAGCAACACAATAAATATTAGACATGTACATTGCAAGTAAATAATACTAAAATGC
ACACCTTTCTAGTGATATCGTAGACCACGATGGCGGCGGCTGCTCCTCGGTAGTACATGGGCGCCAAGCTGTGGTACTGTAGGGCATCAAATAGGAAGGG
TCATCTTTTTGATCGCACACTACATCATAACCAGGTTTGAGAGAACCTTTTCCTGGCCGGCGGTATCCCAAATCTGATACTTGATGGGCGTGTCGTTGAC
CACGATCATCTTGGACATGAATGACGCGCCGATGGTGGACTCCGAGTACGGGCGGAAGTTGTTGGTCACGAAGCGCAGCACCAGCGACGACTTGCCCACG
CCCGTGTCGCCCAGCAGCACCACTTTCACCTCGCGCGCCTTGCTGTTGCCTGCGTCTGCCATTTCTAGTGCTCCTTCGGGTCTATCGTGTTGTTCTCTCT
CGTTTTCTCGCTCTTTGGGTGGACCGTAGATGCTAGGTTAAGTACGCTAAAGAGAACAGTGAGAAACGGGGTAAGTACGAATAACAGACGGCACGGTTAC
TGGCGGTGTCGCTATTGCAGCAACGTTGGTGTTGCCCTTTGCGGTGAGTACATATTGTTGGTGAACGCTTTCGGCAGCAATGGCTTTGATTCGAAGTTGG
ATTCATTGGTATGCACTGTTCGACAATCGACTGCGGACACGAAGCAGCGACGGCCGCTCGATTGTCGATTGCTCGTCGTTGAGCCGCTCCGCCTCAAACG
TATAGGCTCCCTAGGATAGTCTACACATTGCGGAGACAGGCCTCGAGGCGTCGACCAACCCAACGATGGCATGCTCTGAAATGGCTACCCAAGAGATCGC
CATGTGAGTCTCCATTGCATGTGTAAATTACAGGAACTGTACCTGTAATAGGTCGCTGTTGCTGCAACATTTGTGCAACTTAACAAAGCAAGACGTAATT
ACCCTTTTTACGAAACGACTGGCTGGCAGAACGGAACCGCCCAACCAGACGCGTCAGTTGCAGATTTCGGCTTGCATCGGCATTGTTGGTCTCGACTCCC
GTCGGAGATTCCCATCGACAGTGTGCGCCAGAGGCGCTTGCGTATATGGTCTTGTGTTGTGGTCCCAGTGATTTTTATAACTCTAGAATTACACTGATCC
AAGTGATGATCATTTATCCAGTTGAGGGACCCAACTTGTTGTACTAGGGTAGTGAGGAATTGGCAGATCAGGGAGAGCTGCGTGTGAGAGAATGATGAAA
GTCTAGCTTTTTTTCTTAGGAAGTGCCGTCAGATCATGTTGAACATTATGACGACAATAAGCTGTCGAGCTCCTCTCGGGGGCTCCTGAGACTCCACACA
AAGCATCCTCTATCTCTCTACTCTGCATGTCCGTAAGTAGTGTCGATGCTAAAGCAAAAGCGATGCATGTCCGC