Description :
From Genome Similarity Track
Location :
Scaffold_45:158109- 160860
Transcript NameFunction/comments
Physo_136354hypothetical protein

Sequence
2751 bases(100 bases per row)
TCGCTTTAGAACCGTGGGGTTTAACTCTGGACCAAGCACGACGAGCTGCGATACGCCAGCAAAACTCATTGCGAAGTTTTCCAGTCCCAAGCGGATCCAA
TATACCCAATTAGCACTCCACGACTCGGAAGGAGAACGTAGTGGCAAACTTTCGAGCAACACAGTCGTGAGAAGCACGGGAAGCGGAGTCAGAATGCACA
CCAAGAATACTCGAGTTGGCGATGTGGTCTTGCAGTAGTAGTCGAAACTTTCGAGACGCTCGATCGAGTAGGATCCCCGACGACCAACTTGGAATCTGTT
CCAACTCTCTTCAAGGCGCTGCCACCAGCGCTCCCTTGGAGGCGGTGACGTTGGACCATGGGCTGTTGCGCTCATCCCGTCAGCGCGGCCGAATAATACG
GTTATGAGGACTGAAAAGATAGAGAGATGATCGCGGTGTATTCATAGCTTGTGATAATGTTATGTTGTGCCCAGCACTACAAATATCCCCCCCTCTGACC
ATGTGATCAAATTATTATTTCATGACGCACTCTACTTGCGAAGCTGCCTCCGTTTCTGAGTTGATTTGCTGCCAAGAGCCACTTGAACTGGAGCTTGAAG
TCCGCGCCTGGTAGTGTATGATGAAATCAGCTCGATTTTTTTTACTAAGTAATGAAAAATGAGAGATTAAGTCTGGATGTTGGAGTTCATACTGAAGTAC
GAAGATTGATGTTTTGGATGAAAAGATGCGTTTGAACCATACTGATTCGCGCCTTCAGCACAAAAGCGAGTGGATACAGAGGAGAGAAGGCGAACATCCG
CTGAAAAAAACTGAGGTGAGAAGCAAGAGAAAAGAAAAAAAAGCTTCGATACCAATGACTTCAAATAAGCTCAAAAGCCAACCTTGCTCGACTATACTAC
ACCACAACACTACAGCATAAAAAAAGAAGAGAAAAGAATCAGCGTCCACTCGATTCAAACAACACCAATCCGTCAAAGCCAATACTTACTTGTTTCCGGT
AGCCGCCCCCGTCGCCGCCGCTGGTTGCGAGATAATCGCAGCAGCTGCCGGTGTCGGCAATTGCGGCTCGTACGTGACGTAGCTGCGCTTGAGCGTGAGT
CCGTTGCGTCGAATGAACTTGGTGACCCAGTTCTCGGAGGCTTTGAAGGTCGAGTCGGAGCGCTGGAACATGTGCTGCGCCGTCTTGGCGATCCACTTCC
TTGTCACGCGCTCCTTCTTGGCTCGCTCTTTAATCACCACGACCAGTAGCTTCTCCTCCGAGTCCTCCAAGTACAGCTTGCGTCCTCCCCCGCTGATGCG
CTTCTTGCTGCCAGAGTCGCCCAGAATCTTGTCTCGGTTCTTCCACCATTTGCGGAAAGAGGACGCGCTGACGTCCCAGTTCAGCGCCGCAAAGTGCTTC
TCGGCACGGGACGGGATCCCTTTACCCGGACCCATTATCCACTCAATGGCCTCTTTCTTCATACTCAATGGGATACTTTTCCGTTTCATGGCCGTCGTCG
AACTCGCCTGGTCTGGGGCCGCAGCAGGTACTTGGACTAATGATGGTGATGGCGTTGCAGTGGTTATAGGTGTTGTAGGTGCACTCTCCGTTGTCGAGTC
GGAGAGAGGGCCAATGGCGGCTGCAGCTGCAGATAACGGCATCAGGTCCATGACATTGCTGGCGCTGTGGTCCACTTTCATGGTCTTGGCTGGTGAACCG
TCACTACTACTGGTATTGGTATTAGGAGGGACTTCGGCGTGGGCTTGAGCTTGGTTTTGGGCCTGATTTAGCGCTTGCTGCTCCTGGATCTGCAGGAGCA
GGTGGGTCATGGCCGGATCCAAAGTCCCATCGGGTCCGGTTGCTGCATGTACGAGTGCCAGCACTTCCTCTGCGGATGGAGCCTTCATCTTGGAGCGCTG
TAGGAGGCGAGAAACCGATTAGTAGCCCGCCCTCAAAACACGCAGGAAAAATAATGACTGAAAGTTTGTATAAGTCAGAAAAAGGAAAAATACGAAATGA
AATATAAAGGAAGTATTATTTATTTTACGGTAGCGCAATACGTTTTCAATAAAATTCAATAAATATAAGCATTATTTCCTATGCAAAATAGTGACTTTAT
ATTCAATTATTTCATGTAGTTAGATTTGTAGATAGAATTGATTAAAAAAACAAAAGGAATTATTTTATTATGTTCTATTGATAATACATTCAGAGCATCT
CCACCGGTGCAGAGTAAAACTAAAAGCAAATTGCCCTCAGATCCGTGCCTACAACGGCACAACCGTGCTAAAGACAGTGCGCAGCTCCACCGGCCATTGA
GACTTGCAGCGAGCGCGTTAAAGCTCTTAGCACGGCGCCAGCAATGGCGACGGCGAGTCCTAGCTGTATAGCCCTATAAAGATGAAAACGGGTCCGGGAA
CACGTTGAGGAAGACCCAGGGATGACGTAACAAGGGCGACGCTGCGGTCTGTAACGCTAGCGCTGCTTAGAACGCTTGACTTGGCCCTACTACTGGCTGG
TCGACATTTACTCAACCTTTTACTCAAAGCCTCCTCCGTCGGCAAACTTGTACAAAAATTTGATCTGCGTAAAAAATGGAGCAATTTGCTCACCATTTAC
TCAAACCCGTGGAGCAGTACAAAACTAAAACTATAACCAAATATTGACAGAAAAGGGGTAAAATTTAGTTTTACTCACGACCGGTGGAGATGCTCTAATA
TATATTTACGAAATATTATTAAAACAAATATTTAAGTTTAATGGTTTTAAA