Description :
From Genome Similarity Track
Location :
Scaffold_1457:1581- 7323
Transcript NameFunction/comments
Phyag_g10677conserved hypothetical protein
Phyag_g10678hypothetical protein PHYSODRAFT_466741
Phyag_g10679mitogen-activated protein kinase, putative
Phyag_g10680hypothetical protein PHYSODRAFT_558057

Sequence
5742 bases(100 bases per row)
TGACGAAGGGCCAGTCTGCGCGTCACACGTCGTTTAATTGGTCGGACACCAGTGCTCTGTCGGAGGAAGCCCGTCATTGCCCGGCAACCGAGGTGGCGCT
CACTGCCGGAGAAGTGTTGTATCTTCCGTCGTACTGGTACCACCACATCGTGTCACTCGACACCAGCATCCAGTGCAACCTGCGTTCGGGCTTCACCATT
CGTGACGATACCAAGCAATTTCTCACTAACTGTGGATTCGGTCCGTCTAAGCTGTAGCGGACGAATCAGCATGAAATGGTAAGCAAACTCTTTGAGTTTA
TGATTGTGGATGTTATTGCGATGTCGTTGATCTTTCAGAACGACTCGAGTACTCTACTGGGTAACATTGAACCTTCCCTCCCTCACAAGTATCATGGAGC
TGATCACTGACGCAGGCGCTGAGGACCCACCGTGCCAACGTTTGAGACTGAGAGTGCAAGTGCAAGTGAGAACTTCTCATTTGAGTCGGACGTGCACAAG
CCGAACGACTTCTCGAATGGAGTAGTCTTGTACGGCGTGTCGAACATTTGGAAGTAGAACGACTCGGGaagcgagctgctccatGCTTGGTAGTCGGAGT
AGAACTTCTTCGTGCCGTAGGTGCTGCCGTAATTACCCATGAGCGTGCCATCCGAAGGCCACCCCGTCTCCgtaagcagcagcttgtcgcCAAAGTTTTT
CTGCATGATCGCCCACTGAGCCTTcacgacgtcgatggcgttgTCAGGGGTTGTTCCTGGAGTAAAGTAAGGGTGGACATTGACACCAATAACATCGCAC
GCATCCACGAGATCCGACCACCCAGCGATGCCCGCGTAGTTAATGACCTCGGTGTTTCTCTGCACGGTTCCGACCTTCACCGTGCTGGGGACAATCGCCT
TGATGCTCTTGATGCCTTCGATCATTTCGGGCGGCACTTTTGTTTCACCTGCAAGGTTCTCGTTGCCAAAGAAGATGTAGCTGACCTTGCCGGTGATGAC
GGCACTGAGAGCGGCTTGCAGTTGCGCCTCATAGTTGGGTAGAGGATATGGCACTCCAAGCGCTACGAACATGCCGAATTCACCGATAAGCTGACCCAGG
TTTGTGCCGCCGAACTCGGAGATGTATGTGCGGACGGCGGTGAACCCGTGGTTTTTAATGGTGGCCAAGTCCGCTTTGACGCTCTCAGCGTCCATGGTGC
CGCTGGCAGAGTGGTTGGGATCGTAGCAAACTCCATTGGCGGCCACCTGAGCCGCGAGCATGGCGATACTGGCGAAAATGGGAGCAAAGAACTtcatggc
gaaggcgtcgTGGAATCTGGTGTGCGGAGTCGAAGGCAAGTTGGAAAGTGGCCTTCGATCAAAGAGCTCTTTCGGCATCAAGCAAAACTTCGGAGACCGA
GTCGAGATCCGAATATTTATTAGGCACGCGGAGAAGTATCCGGTGGCGTGCCATGTAAcagctcaacttcaacgaaAGCTCGCCGCCCTTCTCTTCATGG
TCACACTTCCAGGACAGGCAGCAacatggcggtggtggtgctggaacaAGCCTCCATGCCCGAAACTCCGGTCGAAACTGATCTATCCCTACTTCAGTCC
AGAGCGCGCGAAATTTGAACCAGCTCGACTGCACGATCGCGCATGGTACAGGCGATGGCGCTAGCTCTTTCGACCTTCAGGCCTGGAGCATCAAAGTTTG
AGGTGATCTGCACCTGGGTGAGCTGTTAAAAGCAAAGGTATGGATGGCGCTTCGTAGTTATATTATTTTACTTATGGGGTATCCTTTCTTGCATGGCCGT
TAACTTGCCGAAGCAGTCATCCCCATTCGGAAGAACCGACTGGCAGCGGCGCTCAATGGCATTGGTGCAACTGAGGTTGGCACGGGCGGGTGGAACTGCT
CAATATCTTCGCAGAGCAGATCGATTAGAGCATCCTTGGACAATTGCTCATCAGGTAGATCGAACGAGAAGTCGAACTGTTTTGAGACCACGAggtcgtt
ctcgtcgaagaACGTAGCTAGATATGGGTGCCGTAATGCAGCGTCCACTGAAATGCGCTTTTCCGGGTTGAAGAGCAACATCCTGCTCAGAAGATCGACC
GCCTCTGTACTTACGGCATTCTCAGCGCCACTGCCAGCAAATACGTCTCGCCATTTCTTCGGTTTAGAAATGGCAAGCTTCGTGAGGAAGCGCAGAGCCT
TGGTGTTCTTGACAAAACCAATGTCCTCCTGCTTTGGGGTGCCCAGGAACTTGATGATTAGCTTGAGCTGGTGCAAATAGTCGTTTCCAGGGAACAGAGG
CTCACGTAGCAGCATTTCTGCGAAAATGCAGCCCACCGCCCATACGTCAATAGCTGCTGTGTACTGCAGACAATTCAACATGATCTCTGGCGCGCGGTAC
CAGCGCGTGACAACGTATTCAGTCAGTTCACCAGGATTTACCAGATCCTGTTGTTTTCCCGACAAAGCGCCAACTCCTCCACGAGCGAGACCAAAGTCGC
AGATCTTGAGGTCACAATTTGCGTTCAATAGAATGTTGCTGGGCTTCATGTCACGGTGAAGCACGCCTGCTGAGTGGATGTGGTGTAGGGCGCAGAGCAT
CTGATACAAGAAGTACTTGACGTGGTCGTCTGACATCGGTTGCATGGAGTAAATGACCTGGTGCAGGTCAGTCTCCATAAGTTCTGTAATGATATACATA
TCGTCAAATTGCTtgcgagacggaggaggtgatAGATCCAGTAGCCGCGTGATGTTCTTgtggttgaagtggccaAGCAGCCGAACCTCACGCAAAATGC
GCTTTGCATCCACCAGGTCTTCGAAAATATTGGTGATTTTCTTGACTGCTAAGTTTTCGCCGTCGTTGACAACGTCCTTGACTGCAATCACAGCGCCGTA
CGCTCCGTTTCCAATCGGTTTGACTAGCTGATAGCGAGTATCCAACGTGAAAACCTGTCCATTCGCGTTGAAGGAGTGTGTCTGTTGCCGCATCATCGGG
AATAGaccggagctgctgctagcaGCCCCAAACGCGGCACGAGGAAGCCGTCCATGCCCATTTCCTGCTGCTACTGTTGCCCGTGAGCTGGCTTTCGTGT
ACTCGTCATCCAGCCCCACACTTTGGTAAGCAGAAACGCCTCCTCCTGCCAAAACGGCACTTTTATACGGGGCCACCGAGCTTTGTGTGGTAAGATCCCC
TGCGACAGAATCCTCTTCGGAATCATCCTCACCCTGGTTGTCCTCCTGGTTGTTGCTTGCCTTTTCATCCGCTGCGTTATTATCAGTGTCCTGTGAGATC
GAAGACTCCCTTGATCGATAATCCGGCGTGCAACAGTACTCGGGGACTATGTGCGATGGACTTGCAATATCAGGACTTGCAATGTCGGGAACTACCCTAG
CGGTCGCTTTCATCTCGTACAccatctcttcctcctctttttcctcgtcctcatcctcaATATCCTTCCTCGCCGCGCGAATTTCTTCAGCTGGTAGGTC
AAGGTCGGCATCCCCACTGTTATTGTTGCTGCATTCACTGCTAGTGTAACTAATCGCGCTGCCATTGTGGCTGCGCTCCCTCGTCATCAGCATCGCGCTG
CCTCTCCGCCCTTCATCTCCAAACATCGGGACGATCTTTGCCGGTTCCGTCGCTGCATTCCAGCCAGTAGCCGCTTCGCCAAGTCGGTACTGCGTCTCCG
CCTGCGTGATCAGCTTCCCAATACACGTACtcagcatctgcagccaCTTAACATGCGTCTTCTCATCTACCGCTGCAAGTCGTAGCAGTTGTGagcctcc
accgtcttcctcctcctctcgaTCTTCAGTATCTCCGAGTTCTGTCCGTTGATCCgccgacgccagcaccagctccagcgcgtgCTTCACCTGTCGATGG
GACCTCAAGTCCGTCACCACGTCGTTCTGCGACAGTGTCACAATGGCCACAAGACGGCCGGGTTTCCTCGTTTCAGGCAAGAACCGGAACTGTCTTAAAG
TGAATCTCAACTGGCTGCCCAGCGCCCCCGCGCcgctctccatcgtctgctCCAGTATAAAGTAGCAGGGCTTGGACCGCCAATAGCGCTGCCGCATGAG
GTGAGTGAGCACCCCTTCAAGCAGCACCTGGGCAGCGTCTGCCTTGGGTGTTTGGGGCTTGTTTTGGCTGTGTTTGTTCCTGTTGAGACTGAGCgatcgc
agcagcgcgcgcatGGGCGAGTCCACgtgcgtcttggtctcctcctcctctccgtATAGTGACCGATCGTCCCGCAGTGCTAGAGGCTGCGGCGTCAGCG
GAGACCGCTCTTTGCGTCGGAATAGACGCGCTAGAAGCGTTTGGGAGCGCACTCCACTGCTAGTACTaccgttgctgctgctgttgctgttggggcCTGA
AGGAGGGGGCGAGCGCAGACGAGCGGAGAGCGTCGAGGGCGCCGAGGAAGGAGACGGCGCCGAGTGTTGCCGCGTCATGATGGCCAGCGCAGAGAGACGG
CGAATGGCACAGCAACTATTCAAGATTTCGATCGAAGAGGCGTGGGGTGAGATGGAGTTTCAGGACGACAGGCTATTTTAGGATTACTCATTTCTGGTGA
TGGGGACAGCATGTCGACACCAAGCCACCTCACCAAGGACCAAGCGCGCACAGCACAGCGAAAGTATCGACGGCCATCAAGATGGACCACATGCTGGAGA
CCAACCAAGTCCAGCGCGTCGAAACCTGCCTGAGGTGCGATTGGTGCTGATCACGGGGTCTATCCAACTGAAGGAGCTGTGGGCTCCCGTGATCGACatg
ctgatgaagaaatGGGACGCCAACAAGCAAGGACGGAACCTGACCATCCTCACATTCCACAACCGTGGCGTGGGCGGCAGTGACGCGCCCTTGGGGCGAT
ACACCACCACTTAAATGGCCGATGACGCGGTGGGCCTGCTAGACAATCTCGGATGGGAATCCGCGCACTTTGTCGGCATCAGGTGAGAGTCTCAGAGAAC
TGTTGTGATATCCGACGATCCCTTATCGGACTCGGGTGGGTTGTGTGCGTTGACTATAGCATGGGAAGCATGATCTCGATCGAGCTCGCTTGCACTTATC
CGGAGCGTGTGCAGTCCCTGTCGCTATTGGTGTCCACTCGCGGCCGATACATTCCGGATGTGCGATCAATGGTGCCTTTGCTCGGCGCCATCTTTTCACC
CACGCAGACGGGTGTCGTGAAGAACACGGTGTCGTTGAACTACCCGTTGGACTTCCTCGACCGCCCCATGGGCGACCAGGACGTGCGCAGTGTGCTCGAG
CGACAACTCCCACTCCACTAATGCCTTCTCGCCCTCAGAGCTAGCCCGCATAGATAAGATCCTCGTGACTTGCCACTTTGGCCCTTCAGCGGGGTCGGGC
AAGTATCCTGCCGCCATCAGCACCTCTTTGGTTACTTGTGGCGCGCTTAGCTTCAAGACGCGCAATATTCCTTGCACAGCCGCCTCCACGCAGGTATCCT
TGACCTTATTTTTCTCCAGATGCTGGCGCACGGCTTTCGCCGCCGACTCAGGGAATCGCAGTCCTTGTAGTCGGGGGTCGGCGTCAATTAGTCTGTGCGC
GAGCACTAGCACGTCCTTCGTTGTCGGCATTTTGCGGGAATTCGGCGgcgggtcgtcgtcgtcgtcgtcgtcgtcgtcgtcgtcgtcagggAGTGGTTGC
CGCCGCTGTGTCAGGTGGcgccttctcttcctcgtggtCGGT