Description :
From Genome Similarity Track
Location :
Scaffold_3:158011- 160359
Transcript NameFunction/comments
Phyin_T30-4PITG_02095Putative uncharacterized protein
Phyin_T30-4PITG_02096Polycomb-like protein

Sequence
2348 bases(100 bases per row)
TGCAGATTTACTGTTCAAGTTGCTGGTAGGGCCCTTATCCTGTCCGCGCATGATACTGGCAGGGAAGTCTGGGGTTTCTTCCGGTTCTGCCACCTTTAAG
TCCAGCGGATGCACGCGAGAGATGTAGCGCTTCTTAGCCATTTCCACGAAAGTTTCACGCACCAAATGGCGGCACTCATCCAGTTCTTCCTCGCTGATTT
CCTCCTCCTCTGTAGCTGTAGCCTGCTCTCTGTCCTCCTGAGCCTTCACTTTCTGTTGCTGACGTCGCTGTTCGGCCAAACTATAGGCCATTGTCTCGAC
AGACTGGTCTATACGCACACGCCCCTGCACCAGCACTTCTTCCATGACCACTTCGCCCTCCAAGCCGAACAATTCTTTAGCTAACTCGATAAACTTCGGG
AATCGCAGGCGGTACAGCGCTTCCTGCACGTTAATCTGCCACAAATAAAGCAGATTAATAGCTTGCCATGAATACAAACATTACATAACTGCAATTCGCA
CATTGTACGCGACCGAAGGCGCACCACCTCGAGGTGTAGCCACGGGAGTCACGTCCAGCACATTGTGTTGCAGCAACTTGAGCAGCGCGCACTTGATCTT
CATATGTGCAGCATAACACCAAGTTAGCGCTTGAGGAAATGACATTGAACCGCCACATTTTACGCACCTGATGCACTGAAGGCGCCGAGGATGAAGCCGC
TGTCTGGCGCTGCAACTTGTGCGCGATCTCAGCCAGTCTCAGGCCCTCGGCGCGCAGCAGCGTCTCGACCACCTTCTCTGCTACATCACCAAAGTCCTCA
CGCACGATGCTCAGCACCAGCGCGCGCTCCGAGCGCGTGGCGAAGGCCGCCTTCTTGTCTCCGGCCGCCATTCGTCCGCTTATGAGCTTGTGTCCGCCAG
CCACCAGCCCACACTCTAATTTAATGTTGCAAAACACAATTTTTGATGGTGGGTCAATTCCTGTGCAACTTTGGCGCAACTTTACCAGCGCAATTAGATT
TTGGCGGCAATTGCAAATATGCCGCGGGACGACCAAAATGAGAGCCACAAGCTACCACACGACTCAGATGATGGAGACGCCACCGAACCTTCGGAGTCTG
AGATGGAGGAGCAACTTTGTGCACAGGCTGCTGAGGCGTTCAATCATGTCGTCCGCTCGCATCAAATTGCCGCCAGCGTAAGCAGCAGAATTGATTCGAG
TTGACTACTTTATTGTTTTTCGATGGTCGTCACATGGATACAATTATTGTAAAATTATTGAGTAGACTGAAGTGGCGCGCAATCGCCTCAAGGGCTCGCT
GTACATGGTCGAGCAGCGACGTAGACGACAACAGCACCTGGCACCGCCAGACGAAGCGCTGCTAGGCATCAGAACACAGAGTGCGTCCACATTTGCAAAA
ATAATATTTTGAAGTGAAAAGGAGCTAACGATTATTGCTTATGCTTGCCAGCATCGGAGCTGCCAGTGGAACCAGACCTATACGCGAAAGACACCGTCAA
GTTCAGCTTGCCGAATCCCAGCACGACAATGTACAAGCGGGCGGTGATTCTGCCGAAGATTCCGTCAATCCCAACGGCAACAATGTGGACGGCACTGACC
AAAAACTACGAGGTGGAGGACGAACCAACGTTGAAGTTTCTGCCGTATTTCGGCGACGACGACGAAGAGGACGTCGTGTCAGAGTTCTACCAGATCAAGT
GAGGAGATTTTTATGCTTGTGGAAGGCGGTTGGTTGGCACTGACTGAGACTGACGAAATTGATGCGCGTCATTGTCTAGACAGCAGAGAACCAGTGCGTG
CGAGGTGGAATTCACCAAGGAAATGTGTGAAGGTGTGCTCAAGACCCTTCAGTCCACGTGGGATCTCACGCCGAGCGATCTCAAGCGTGTGGCCAGCGTT
ATCCATGTGGAAGAGGAGGTTTTGGTGGAGGTACACAAGAATCTACGTCTGTCGCAACGTGCAGCCAAGAAGAAGCGCCGCACGGAGGCGATGGCTGCTG
CAAGTGCACAGACTAACTCGACGCGGATAAACGGCGAGTCGGACTCTGCTGATCTCTCTATGGAGGAATATTTCGAGCTGTACGAACAATCCGCGGACTC
CTATCGCAGTACGTGGCATCCTGTCACTAGCTGGGTTATTGGTTTGTGGCGTTAATACACTCAATGTCTGCGCTCAGGTCTATTCTGTCGACGCTGTTGC
GTCTACGATTGCGACTACCATGGATGCATCGATCAGCCGAAGCTGGTAAGGAGACGTAGTAGTTGACTATGTGCCTTTTATTGCGCTGATATGTCACACG
TTTGTTGTGGCGCATAGAAAATCTCGGCGCAAAATGCTGTGGCGCTGA