Description :
From Genome Similarity Track
Location :
scaffold_257:15800- 20458
Transcript NameFunction/comments
Pl_106947hypothetical protein PHYSODRAFT_445559

Sequence
4658 bases(100 bases per row)
TCAGATGCGGAGTTGATCTGCAGGGTTGATGCCTGTCCAGCCTGTCATTTCTGTGTCGGCGAGACGGAAGTCACCGTCCATTTCGACGCAATTACGTACG
GCGTATAGCAGTCTCTCACGACAGATTTCATCGCTTGAATATCGTGGAAGCTGTAACGCAAAGAAACAAGTGTGCGACTTGGGCATTTGTGAGTCCATCC
AGCCTCCAGTAGTTGCTGTTGCCCCGTTGCCATCTCCTGATCCGGACGATGCAAGAGCTTGGATTTTGAACTTTTGGTGAAATTGTGCTGATCCTACAGG
TAGACGCGAACGTGCCCACACAAATCTCAAGAATGCCCGCTTATCTTCCGACTCCAGACTCTCCAACACACGCCAGAATCGCTGGATGAATTCATCATTT
GGCGAGAGCTCTTCGTCATACTCGGTGTTGTCCTGTAAGAGCTTCACATCCACTTCTGCAACACCGCACATTCGCTTCTCAAGCTCAGTCCACGTCAAAA
GCGCCAATGCGGATACTGGCATGATGGAATGCAGTCCCTGTTTGACAATGTTCATCACTTCCTGGGTTTCTTTAACACGGGCTTGAAGCATAGCTTCTAG
GTATTTTCCTAAGTTGGTTAGCGTCACGGCAGTGTTAGTGCCGTCCTCACAAAGCTCGACTATTCGCCCATCCGACAACACTGTCGTAAAGACCAAGTCC
ATAGTCTCTAACTGCTCCTCCAACTCGAGGAATTTTGTCGATGTGGAAATTGTTTCCGCAACCTGAATACGCTTGAGCTCATCATAAATGCCTTTCAGTG
TCTTCCATAGAGAGTACGCGACAAAATCTATCTCTTTCAGTGTTTCTAGTGCGTTCTCCTGGTTCGAGTCATCTTCAGCCACGAGCTGCTTCCACACTGA
CATTGCCAAATCGAGGCGAACACACACCCGAGTCCGTAGACAAATACCAATCATCTGTCCGAGGAAGTAAAACATCTCGCAGTAAAGCTGACGTTTTTCT
TCAGCACTTTCACCTGGTGATGAACGGGTTTTCTTAGCGTCACCAACGTTGTGGATAAGCGCACCATTAAGCACAAACTTTTCTCGATTTGCTCCAACAC
CATTCCGCCAGTTCGGACTTGGCATCAGGAAGGGCAGGACGCAAGCGGATACAGAAACACCCGGGTCCAATTTCATAGACGTACTGCTAGGGCCTCCATT
TGCAGAGGCATCCGAAGTCTTGTTCTCGCTGTTTTCTGTTTCTGGTGCGTGAAGCATCTGTAATTCAGCGAAAAACTGCGAGAAAAACTCTCGGTATGGA
CCACCATAGTCATCGACACCTTCACCCTCGAACTTCACCTTAAAGCTTCGCAATTGACCGTCGTCCATCGGATGCGAGTATACCATTCGCAGGGTTTTGA
GTGGCAGGAAGTGCAATTCTTCAAACGCCTGACCAAAGAGCGACAGGAAGAGGCTACTTACAGTCCCCTCATGGCACTTCGCTGCTGCAGCCTTCAAGCG
ATTCACCTGTAGCTGTGGTAAATCTTCGGGGTAATCGTACTCGTCATCGGCCTTTTTGGGTGAGTTAGCTGTCCTCTCCATTAGTACTGTCCAGAGCGTA
TTCTTCACGCAGATGAAGAGGCTACCACGGCATTGGGATATTAAACGGCATGGTAAAGAGCTCAAATTGGGCAAGAAGTAGTGCCATGTGAGATCAAAAA
ACGGTAAGGCACGACTCATGTACATGTTGCAGAAGCGTAATAGTGCAAAACGTGCGACTACCATCTTCTCCAACTTCTCCTGTGGCATTGCAAGGATGTT
GCTCATAGACGTAAGTTCCAAAATTGCAGTCTTCTCCTTGATGACATTGAAAAGCTGGCACGGTGTCAGATTCCACGGACTAGTTCGTGATACCTCGCAG
AAATAATTGGTGACATTCAGCAACTCGCGATCAACTACAATGCTCCATAGTGAATGCTCCCCGTATTCGACGAGTTCTTCTGGGGACAGATAAAATGACG
GATTTTCCAAGACCAAGCCGGGTTCACTGTCTACACTTAGTTTGGTGGACTCAGTATCTCCACTATCATTTCGTAAGGTAAGTGGGTCATTTGAACTCGA
ATTTGCTGCAGCAGTCTCCACAGGACTCGTCATTGAGTTAGTCACTAGTCGTAGCTTTGACGGATGAAAGAACCACGCTCCAGGCTCATTATCTACTTCT
ACCCAAATTCGTCCACCTGCAACACCCACAACAACTCCATTTCCACGAGGTGTCCGCACACGATCATCGGCGTAAAAGCCTAGCTTCCCGCAATTTGCTC
GAGTAACGTCAACCCACAACGCCTTGCCCGATCGAGTAGTAACATATTTTGTAGACCCAGCGAGCCACTCTGTAGTCATCTTGAACATTGCAGCAGACAT
CTCAGTGCGCATTGACTTGTGTGCAACCCAGTTGGACATAATTTCGCAGGCGATCAAACAGTCCTCAACCTTTGCACTGCAGTCTTCACCTGTTGGAGAG
ATCTGAAGTTCACTGGTGCCGCTACTACTGACATAACTATCCTTTGCGAAGGAGATTTTCTGATGTCTTGAGTAGAATGCGACAGCGGGACATACTTCAC
CAGCAATATTATCAAATGCCACACCCAGATCGACCCCGTTCTTGCTGAACGATAATTCTCCTTTTTCACAATCTAAGCGCAGGCCAATGCAATCTCCTTC
AGTGAAAGTCTCGCCATAAGCCCGAACTCGGTTACGTTGATAGTATAGTGCTTTGTCACCGATGAATCCCCATGATTGGTCATCAGCACCAAGGAACGAA
TCCAAGTTTGCTTGTCTGGTTGCAATCCCCACGAAGAGATAAGGAGAACTCGACTTCTCAATGCGAACAATCCAGGAATGAATTCCCGTGGAGAAGCCCA
CAACAGCACACGCAGCTTTCCACACCTCATTTCCTGAGTACGATACACTAAAGCCATCTTCTGCAAAAGTTAGCAAGCTACTGCGGCTTCGTTTACGATC
GAAGTTCAGTGAAGAACCTTCAGATTTCGGCTGAATTGGCACAGTTGTTGATTCTAGAGATGCCAATTCGCCACCAGTACCGGAACCCTGAGTCGTTGAA
GCATCAGTCAGATGTCGAGCCACCATCAAGTCATTAAAACCCGTCATGTTCTGCAAAATGTGAAGAAGTTCAACGTAGCCCTGAAGGTATTGTGAGAACA
ACAGACGACCTTGTATCATTTCTCGACTGTGCCGTGTGATTGCAGCAGTTAAGAACTCGTCAACAATCAGTTGCGATTCGTTCAGCATATCTTGATTTCC
CAGTGTTACAAGCAACTTGCTGATAATCCGAAGCACAACAAATTTGAGTGGCAAATTTGTAGTCCCAAGACAACATCGTAGCCGACGCAGCACAGTCTTA
GCAAAATCAGCTGAAAATGTGAGCGATGAGCTTGTAGGGCTAGCCAACAGCGTATCTAACAGCCAAATAACAACTTCAATTCCAGGTTCCTCCGCCACAG
TTTTGTCCGATCGTTTGAGATCACGTTGAGTCCATAGTGCAGCTTCGTAAGATTTACCCGATGCTGCAGCTTCCAGTTCATCAAGACAAAACTCGAATGC
TAATGTAGCAAAGGTAACAGCATCGCACCTGACATAGTGCCTAAACGCCGTCAAAAACACAGCATCAACCGAAAACTCTTGGAGTTGTTGGCTATCAGGA
ATTGCTGTGTTGGTTCTCGAAAGGATCGAAAATTGATCGCCGCGTAGCAAAACTAGTTTAAGTAACTTGAACCACTGCGTATATGGGACCAACAAATGGA
GTGTTGATTCAGTAATAAACCGCGGTGCGGTTGTCTGGTGGAGTAACGTGACCATAAACTGACGAGCGTACAAGATCGACAAAGTGTTCTCAAACATTCG
AAGTTTCTCTAGAAGTCCTTTAAGATCAAGCTGGTCGGTCTCCGTCTGGAAATCCTCCTCAAACGGTGAATGTTGTGCATCAGAAATGTTGTCAGTAATG
GGATGCAGGGAAGACGGCGCTGGCTCCGCTTTCATTTCCATCGGGTCAGTCCTCCATGAAGTCATGAACCGTGTCTTGGTGTTGGAGAGAAAACCTCCGT
CTTCAAAAGGAAAATACATTTCACCAAAAAGCTTTCGACCCATTTCTTTATCATTCAGCGGTGGTGCGGTGAAGCTGTCACCGTCACAACCAGTGAGCCT
AGCCTTTGATCCTGGTGTGACAGAACTGATTGAAGACTGAGAGTCAAGTTGTGCCTTATCTTGATCATTTTCACTCAAATTCAAAGGAGGCTGGATACTG
TTACCTGATGTATCGTCAGAAGGCACGATATCGTCTAGTTCCTCGTCAAATCGAGGTGAATCTCGTCCCTTGTCGCGCTCTTTGTCAAGGGTAGATTGTA
GTTTACTCAGATACTCAAGGTTATCAACAATCCATGCCGATGCACTCACAATGTCGTTTTCAGTTTGTTTCAAAGCCAACACGCACCAATCTTCAGGGAA
TCCCATGAGCATCAATTCTTCCACAAACTCAGCTCGGGTTTCTTCAGCTTCGTCTTCATCGTCCTCGTCATTGTCGACATCTTCTAAACTTTCATCCTCA
TCGTCTTCGTCGTCGTCCCCATCATCTTCATCATCATCGTCGTTGTCTTGGGCAGCAA