Description :
From Genome Similarity Track
Location :
Scaffold_1492:158- 2660
Sequence
2502 bases(100 bases per row)
TCCGTCAGATGCGTGGAGAGATCGAGTGCAAGGCCCCGAGCTTGGTACTACTACGTCAGAAGGCCATGGAACGGTTGTGTGGAGTAGCGGCCTCGCAGAA
ATCGCGGAGTTCGTCCTCGCACAAACCCGACGCGTCCAATCTGCGGTCGCGACGGGCAATTTCCCGGATCTTGAGTAGCGTATCTTCGAATATAGAGCCC
AAGTCTTCGCAAGCTTCAGAGTTGGGGGGTTGAGTGGACGCTTGTTCCTTGTCTTAGGGCGTCGGTTGTTCCTTGGGCGTGCGGACTTATCGGGCCGGCG
TTTCCTCGGAGATCCCGTCGGGTGTGCGGCGTTATCGGGCCGGCGTTTCCTGGGGCTTGTTGCGTGGCGGTATCGGGCCGACGCGGGGTCTTGTGCACAG
CGGTTATCAGGCCGTGCGGTCCTTCGTCTAGGCTGCGCGTTATCGAGCGCCTCCTAACCGGTATACGTTTTACGTGCCTTCGTTTCTAGCACGGGGTTTG
AGGGGGGGGATGCCCGAGACAGCGAGCGACGGGGGGCCGCGTGTTCCTTGCGGCTCTGCTTGCCGACGCTTGGTGGTTTTCAAGAACCTGGCGATCTTCC
GGAGGGGAGAGGTCTGAGTGGCTCAGAGAAATTTCGGGACTGAGTCCTTACCCTATCCTATGTCCTTGCTACTGGCTACTCCCTACTACTGCTTACTAAG
CCTACCACCCTACGCCTATCCCTGCGTCTGTCGTGCTTGCACTGCCGCTCTTCAACCTGATTCGCGTAACGTAATCACGACTTGGGCTCGACGGGGTTCC
TCGACGGGGTTTCTCGACGGGGTTTAGGGTTGACGGGTTTGGGGGAAACGGGCGCGCTGATCGGCCCGTCGGATGATTACGCGTCGCACTGGATTCTGGC
ACCGTGTCTCACGGGCCATCACCCACGCCGACTTTCCGTCGAGCTCGGCCCTGCGTCGCGCCCATAATCCGCGTCGCGTTCATCACTCGNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NN