Description :
From Genome Similarity Track
Location :
Scaffold_382:158- 2085
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_382-snap-gene-0.2CD27-binding (Siva) protein
Pytiw_DAOMBR242034maker-piw_contig_382-snap-gene-0.3Serine protease family S10

Sequence
1927 bases(100 bases per row)
TGTAGACGCGATGAGTCGGATGATGTCGGCGGCGGTCACAAACGCGCGCATGAAGAGGCACAGTGCGCACAAGCAGGCCATGGCCATGCTGCCCGCGACT
AACAATGCATGCTGCGCGGTGTGCGAGAGCGGAAAGCGGAGCCAGAACGCACCACCAGCGTTGAACCGATGCGCGTATTGCGAAAAGCTCATCGGCGCGT
GCTGCCACCGTGAGTGCGAGAGCTGCTTCAGCCAGTTCTGCTCCCTCTGCTCCACGCTCAAGTACGTCCAATTGCTATTTTTTAGGCTGGTGATCTCTGA
ACTCGGAAGCTAATATTTTATATGTGCTATTCGTATGCTGCAGTTGCGACCAACAGTTCGACCGCGTGCTCTGCTGGACGTGCAACGGCGCCTAGGCGCG
CTGTCATATAGAGGAGAGCGAGCGCATGTCGACTTGCTCGGACGGACTGTTCTTTAACCTCAAATCTAACTTAAATGTTGCGTCGATCCTGACTTGGAGG
CTTGTTGTTGGTTGTGCATTTTAAGTGAATGAGGTGCTGACGACTCTGGCGTCTTCGAAGAGGAAGCGTCGGACCATCTCGTGCGCCACTTGGGGCTGAT
CACGAGGCACCATCTACAGATTTGTGGTTGGTTGGTTGTGCAGAAAGCACAAAAACGAGTCGTGGGTTAGCATGCAACGTGGCTCAAGAGCTCAATCAAG
ACCAGAGGGTACGTACATGGCCCGCCTCGAACACCTTCATGAAGCTCAGTCCGTTCGCAGTTCGCACCAGCCCGACTTGCTCTCCATTCACGATGAACGA
AGACAGCGGAGCCTCGTTGAACGCTTGCTGGTGACTCCACTGCAGCCGACGCGTCCATTCATCCTGCGCCATCCAGTTTACGACTGTGTCGGCGTCCCCG
CCGTACACGAGCACGCGCACGTTGTGCTCGAGAAGGAACGCGACGCGCGACTCGCTTTCCTCCAAGTAGTCCCATTGCCGCAAACTCATTGTGAGGTCCA
TGTGACAGAGCTGCCAGCTCCGGTCCGTCACGCCCAAGTACGCGAGCACGTGCTTCTGGTTGACAAAGTCTTCGAGGCGGGAGAACCGGTAGCAGAGACC
GATGCGGTCGTCCGCGTGGCATTCTCGGCGCATATCGTACACGTTCCAGCCAGCATCGGTGACGCCCGAGCTCCCGAGCCCATTGAACTGGTGAAAAAGA
CGGACGGCGTCGTCACAGTCGGCTGCTGGGTGTGTGCGCAGCGATCGAAGCTGGCGACTTGGGCCACTGTTGCATCGCTCGGACGCCTCAGCAAACTGCT
TCGCCAGTTCTTGGAGCTCAGGCTTAGTTGACCCGATGAGGTCCTTGCCATACGTGTTTGAAGCTGCGAACCCCACGTACGAATCCACCACCGCCTTGGG
TGAGACCACGCCATTGCCGATCCCGACCCCTTTCAGCACAGGTCTCCACCGCGGACTATCGCTCTTGAGCAGATGCTCTGCCAAGTCCGGGACGAAGTGG
CCGCCGTAGCTCTCTCCAAAGATGTAGAAATCGTGGGTCACGAGCGCCGAATGCTTGGAGAAGAACTGGTTGAGAAACTCCGTCATGTCCTCTGTGGATG
TCTCGTGGGTCCAGAAATTGTCGGCGTCCGGGTCGCTGAATCCCGTGCCGCGCGGCTGGTCGAGGAAGATTACGTTGACGAGCGAGCTCCACGCGTACGG
ATTGAACGAGATCCGGCCAACTTCGTCATCGAAGATGCACGGGCCGAGCTCAAAGAGCCCGCCAGCGAGTCCTGAGCAGCCTGGCCCTCCAGACAACCAT
AGGATGACGGGGGCATCGCTTGGTTTCGAGCTCGAGGACTTGTAGAAGATGTAGTAGAGCCCGCCGAACAAGCCCGTCTCCTTCTCGACCTGTTCCCCAC
AAAGCGAACTGCCAGGTGTGTCCTCGA