Description :
From Genome Similarity Track
Location :
Scaffold_1210:158- 1339
Sequence
1181 bases(100 bases per row)
ACCGTGGCTTCAATGAGTGTCACTCTTGGTTTGTTGCGGTTGTCATCGCGGCGACGGTCATCACGCCGGTTGTTGCGGGCGTACCCATCGTCGCGTCGCG
TATCACGACTCTTGGAGTATCGGTACTCACTGTCTCGCTTGACCATTCTCTCCTTGCCCTTGAGAACATCTTTGATGATCTCTTCGAGCTCGTGAATGTC
GGTGACTCGGGTATGGTAGATATTCTCCGCCAACTTGTCGTCATCGCACGTTGCCAGGAACTGCTGTACGTGTTCTTTCGCGTCGTGACCACGCTTCTCG
AAGTGTAGACGGGCGTTCCGAGCGTAGCCATTCAGCCTGTTTATGTAGTCGCACAGATGTTCGTTACGTTCCCGCTTTGCAGAGTAGTAACGGGACAGTG
CCGTCTGCGTGAGCTGCGAGCAATAATAGCGGATGAACGCATCACTCAACAGCTTCCACTTGCGCTTCGTCTTCTTCGGAAGTTGACGGAACCAATTAAT
GGCTCCGTCACGGAGACTTAGCTCAAATGAAATGCACCATTTGTCCGCATCTGTGTGCGTTCCAGTCATTTCGTAGACGAACCCACGGAGCCACTGCATA
CAGTTCTCGCTCATATTGCGAGAGCGTGAGAGCGGCTTGATGCAATCCAATGGTCGGTGCGACCCCAATTCAATCCTCGGTGTCGGGTCCACGTCTTTCA
GCGTTGCCAGCTCATTCATCTGACGCATCAACTCGAGTTGAGGATCTTCCTCGTCGAATGTACGCACCTAAATGTCATCGTCACTTGACGAACCGTCGCT
GTCGACTTGACGACGTCCAGCACCACCTTTGGGAGCTCGCGCACCGCCCCGGCGACCGAACGAACCCTCGTTACCAGCGTAAACACGCTGCATACGACTC
TTCGAACGTGGCGTAACCATGTGCGAGTCTTGAAAGTACGGTGAAGCTTCGGTAGTGTCAAAGGCACCACGATCAACTCCAAGCTTGTCGGAGGAGTATG
GTCGAGTCGTTGGGGTGTCAGCGGCAGCTGAATCGTGGACGGATCTTCGTCATGAACGGTCGGTCGACTCACAGGCTGCTTTCCAGCGTTGATGCCGACA
GCGCCAAATGCCTTCCGAAGCTTCTTCTTCCATTTCTGGAGAGCAGCTTCAGCTTCATGAGGACTCCAATCTTGAGCGACA