Description :
From Genome Similarity Track
Location :
Scaffold_1029:158- 1194
Sequence
1036 bases(100 bases per row)
TCCTGCCCTCAAGAACCGGAACTACATTGGCCGTACGAGCTCCGAGAAGGTTGGGAATTGCGAATCTAGTGTTGGTAGTGATAACTGGATAATACATTGG
CCAGATCCTACAACCTAGTGAGCTTTTCCTTTACTCGTGCAGATCCGACAGGTTAACCGAATTTACTACTTGGTCGGTTACACCCTAGAGGTTCTCAACT
CTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACTTAAAGGACAACACAAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGGCCGGATCCACGATC
TAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATACGGAACCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCATCCCCACG
TCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGAAAGTTCA
GCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTGGCAATCTCGCAGATTTTGCTGATCCCGCTA
CACCACACAATCCAGTATACGACACCGTCCGCGAGTTCGCGGATGTTTTTCTTGACAAGATTCCAGCTGAGCTCCCTGCTGACAGAGGCATTCGCCATGA
GATTGATCTCACGCCGGGTTCCAAGTACTGTGTGACGCGACAGTGGCCCCTCCCACGCGATCAGGTTAAAGCCATTGACGACTTCTTCGAGAGCCGCCGC
AAAGCGGGTCACGTGCGCGAGAGTACCTCGCCACACTCGAGTCCGACGTTCTGCGTGAAGAAGGCCACGGGTGGTTGGCGCATTGTTCACGCTTTTAACA
AGCTAAACGACGCCACCATTCCAGCACAAACGCCGATCCCTCGGAAGGATATGGTACTTGACACCATGGGCCGCAGTGTTATTTTCAGCACCATCGACCT
GACCGATGGCTTCTATCAGATCTTGATGCCACTCAG