Description :
From Genome Similarity Track
Location :
contig_237:15799- 18421
Sequence
2622 bases(100 bases per row)
CCAACCCCCCCGCCAAACTCCGAGAAGATCCAGCAACTGTACAACAAAGTGCGTCCGTACGTTCCAGAAGAGTTTGTGAACGATGCACTGTACGCTCCGC
CGAACGACGAAGACGAACGGAAAGCAAACGAGATCAAGAGGGCTCGAGCTGCACGCCAAAAGGCATCCGCCAAGAGAAAGAAGCTTGAAAGAGAAGCAGC
AACGAAGCGTGATCCACCAAGTGAAGCTGCAGTGAACAGTGCCGGTAATGAAGCCGAGGCAATGCAAACCGAGCAGCAGCCAGCTGAAGGAGATCGCAGT
GGTCGAGACGAAGCATCCATGGCGAAGGAGCCGTCACATGTGAAGAAAAGACCACGTAAGGAAACGTCGTGACTGATGCGATTTCCGAGCCCGGGCAGTG
TTTTGTTCTCGGTAAATCAAAATGATCCATCGCTACCAAAATCCTAAATATACACCTCGATTTTTGATTTTCTGAATTTGGTGCTCATAATACTGCGTCT
AAAACAAGAAGAAGTCGAATTAGGAGCTCGGAATAGGCGCAACGGCTCCGTTGGTTCAGTTTACCCCCAGTCAATCAATAAAAAAAAATCGAGTTCGGCC
AGATCTCGAGGCAACACATTTTTTCAGAGACCCTCACTCAGCGAAGACTACGTGGATTTTGGTGCTGGGGAGCTCTACGTGTAGCTGAGACTCTCCTCTT
TACGATGGTGTGCCCAGCTCGTAATTTTCTAAATGGTTAACTAGCATTATTTTGTTTCACGCCGTCTCATATTCGCTACAGCGGATCCTCTCTGGGGTCT
TGATCGGCCGATCTGGGCCTTCACGTCAAGGCAAGTGTTTCTGGCTCTTGCACGGTAAGCATCCGTATCCTCTATGAAGGGTTAACCCTCTCGGGCACAG
CTGCGGTCCCGTCGTCGGTATTGGGTCTTCACGTGTAGAGTAACCAGCTCTTAAACTCCGTGGGGTGCCGTTTCCGCTGTTATTTGGGCTTTATTGAGGT
CTTTCTGCTGGGCCGTCATGTCAAGAGGTTCGTATATGGACTCTGTGTTGCACTCTGGGAGGGGAAATCGCGAGCGTAGAGGGGTCCCATCTCTTCTGTG
CGTGGTGCTTGAACGAGAACGCGAGGGGCTCACCAGGCCCGAGGTGTCTTGGTGTGTGAGATCTTGAACACGTGGGGATCACCAGGCCCTCCGTGCTTTG
GTGTTTGGGTTGCGTAACCGCGATGGTTCACCCTGTCAACGCGCCGTGGTAGGTGCTTGTCTTGAGCGCTCCTAAGGTTACCAGGTCCTCGGTGCGCCTT
GGCGACGTAATCTTCTTGGGCACTACGGGGCCGCCAGGTCCGTTGCGTCTTGGTGTGGTCTCGACTTGAGGGCTCGCAGGGGTCACCAGGCCGCGCGCCC
TGAGGCTTATGAATTACTTGGTGGTATTCGCCAGGTGGTGGCCATCACCCTCTAGCGTACGGGGAACAGCTCTTCTTTCCAGCCCCGCCCCACACGGGGG
AAGTTCGCGTCCGAGAGAAGGAAGATCCGGTTACCTCGGACACTTGTGCTAAGCGACGCGAATTGCGAACTCGCGCGGGCTTAAACCTAGGATCATGCAT
GTTCACACGATGTGGCTCACATCTCGCTCGTGTATGATTTCCCGCCGCCCTCAGGGTACGTGGGGTGAGGCGTGGGTGTAGATTTCTTGTCGATAGCTTC
GATTTTGTGACAGCCGCTCTGCATTTTTTACCAATGTCCTCTGTCTGGTGATGCGAGCGCAAATTGATGATGCGGCTGTCATGATGATGGAACCATGGTG
ATTAGTTTTTCGATGTCAGCAGCTGGTGTCGGTAACGTACATAGTACACACGTCTCCATTTGAGATATCCTACATGTACCCTGAAGTCGTAGCGTTGAAT
ATATCGGCAGGAGCAGCGTGTATTTTGCACGAGAGTGCAAATTGGTTGGTGAGCACGCAAGGCTGTCACGCAGTAAGATCGTAGATTAGAAACAGTCGTT
TTAAATTCATGACGAGCCACCACTCCTCAACCCCGGGAAGCCTCTGCTTCGTGGAGTTCGCCGTTAGATTCTACCTCTACCCTCTCAATTCGAGCATGGC
CACAAAGAGTGTTTGGCAAACACTACTCGGATGACAAGCCTTATAATTGTTGCCGCCGCCGCTGCCGTATGTACCAACACCAGCTACGGGAGCTGATGAT
GTGGAGATGGGTAAACTGAAAATCTCGTGGCGTTCTCTGTATATTATACCAGTAATTTATAGTAATATAGAGTGTGTATGGTCATGTCGGTACAGAGCGC
GCCACGAGATTTTCAGTTTACCCATCTGCATTATCTGTGATCGGGTGTACTTCCATTTTTGTAAATACACAATCGCTTATCGTGATTCCAAGCTCCGTGC
ACGGAAGCTAGCCGGCATCGTACATGCACAGTAAATGCGACTGCACGATAAATGTATTATTATTAATATACAATATATTTTTAAAATAGCGAGGTCGTCG
CGGATTGCGAGGCCAACGGAGAGCTCTAACGGAGCTGCTGCCATTATGGTATGCGTGAGAATAGGGAAACTAGCGGCATGTATGGAGGGAAGAGACTCAC
TCTCCTTCCTCCATATGCCGGT