Description :
From Genome Similarity Track
Location :
Scaffold_1:15798- 19255
Transcript NameFunction/comments
Physo_127021hypothetical protein
Physo_127022hypothetical protein

Sequence
3457 bases(100 bases per row)
GGCGGTCGCAGCGCCGTGTGTGCGCCGGCAACATCATGACCACGGACGCTTTGGGCGTGACCGTTGTCGTGCTGGAGGTGGTCGTGGGTGCCTCCACCGG
CACGGAGGTTGGCAAGGATGTGACCGGTGACCAGACCGCGTGCGCAAATGCATCGACAGTGCGGAAGGAGACCGTTGTAGAGGTGCCAGCAGTACCGTCA
GCGGCGTCAACAGCATGACGTCCTTTGTAGAGATCGTGTCCGTACGGGAGGAGATCGGAGGCAACTTCGTCAGCATGGAGTCGGACGCAATGGTAGCGGG
CGACTCGGGCAGCGAGGGCAGCGGCCGTGGCAGCGCCGTCAGCAGCATGACCTCAGATGTGGTGGTGGCGAACGTGGCCGTGCTGGATGTGGTCTGAGGC
GTCTTCGCTGACATATACACAGTTGGGAGTTATTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAAATGAGGGAAATGCT
TGCTAGATGTGCGTACAGTGCCACGACCATAGAGACCAATCGATCGTAAAGTCTTCAACAGCAAACAGGAAGTGTAGAAGTTGTCTGTGTTTACAATGCG
ACTGGATCCTTTCAAAGATGAAGTAACCGCCATGACGTGAGAGCGGATTTCAGACGACTTCGCGGTTAGATCAGCGAATTTCTGCACTTCTGAGCGTGGA
ATTACACCGTCCAGCCGATCATCAAGTTCACTGGAGCAGTGCAACTTGAAACTCACCGCGTACCACGAGGTAGAACAGCAACACACGTATAACTTGAAAT
GATACTTTCCGGTGGGTTTTTGTGGGTTGAAGACTATAATGTGGCGGGCGTACTGGGATCGGCAGGCAATTGTGGCCTCATCAACAGCCACGTTTCGACC
GACTTCGACATGGCGCAGGCATCGCGATTTCAGAATGCTCATGAGTGGTCGTATTCTAGCTACAGGACCGCGCTTGATGTCGGAGGTAGACACCTTGGAA
CGAAAACTCAAATTCTTACGGATGTACAGGAATCTTCGCCATGTCATAATTGACTTCAAACTAGTAGTACGCGCTCCAGGAAAAAATAGTTGCTTCCTCG
TCGTCCACCCAGTAATTTCTCATCTCACCCTTGTCGTACAGAGTCATGTACCAGAGGATCCCATCCGGATGTGTAAATAGCCCTGACGGTTGGCCAAGCG
ATGCTGTGGGTGAAAATGTCATTGACGCTATCTCTTCGACTTCACCAGGGCACAAAGGGCGCTGCAATTCTTTTCTGTCTTCGGGCCAAAGACCGGCTCC
TCCTGTTCCTCCGTATTTTTGCTTCTTTTGCGGCCGCGCGCCCTATCTTTTTTTTGGTCTTGACATCAGCACTCTGGGTTCTTGTCTTCCGCTTGTTACT
TGTCGCCGCGCAGGACTCAGCGGCCAGATGTCTCTCCTTCATTGTCGCTGTCCGGGTAGTCTTTTTTGCTGCGCACATCTGCTCGACCTTCTGGTTTCGG
TTTGGCGCAGTTGGTAGAAATGAAAGGGGTCAGGACGGTAAAACACATATTAAGTTACGAGTTCGGTGACGTAAGGTACTATTCCCCGTTTGCCCTGCCA
AAACTGATTCATGGAAGTATCGACCGTTGGACAATCCATTTGCGCTGGCATCATTCAAGCATCGCAGCCAAGTGGCGTGAAACAATGGAGCGCTGGGTGG
ATGCGCGGACACAAGCGATTGAGACGATCACAAACATCCTATGCAATAGAGCTTGGCCTCACGACAAGCTAGTGGTGCTCTTGCGAGGTCTCCCTGGTAA
TGGAAAGACTACGTTCCGCGACCACTTAATTGAGGAACTTCGGCGAGCCATTGACTACGTGGATGCTGAAGAGGATTCGCCACGGCGCGTTCGCTTCTGC
AGCAGCCCCTTGTACCTAGGGTTGGCAATTCACGTTTAATTACCAGTTATTAACGGTTACATTCAGTTAAAAAGAATGTTCACACGTAATTCACAGCTGA
TGTTGTTCACGCTTAACGTTCAACCTCCGGGTCTTGTTCCGTCAAGCCTCCTTCTCGAACGAGTCAATCCACATCGCGTGGACTTCTCTGAGAACTTCTC
GGCGCAACGCGCCCTCACATGACTTTAAGTCATAAAGCCTTTTGGTCTTTCGACCGCAGACAGCCTCTCGCGAGATCGGCCTCGGAGCCTCGCTCCGCTC
GTGCTGCTGCACTGCGTGCCTCCGCGAACGCCAGCGCCCCGCGCGCACACCCTCGACGCCTTCCAGGCTCTCGGTGTCCGAGTACTTCGCGGCGCAACGC
CTGAAGCGCAGCTCGCAGCGCGCAAGCCCCAGCTCTCCTCAAGCACCAACCCGCCAGATCATGGATCCTAGAGAACTCTTTGGTGATGACGGCGAGGTGG
ACGAGTCCATGGAGGATTGTCCGAACCGAGGAGATGCGTCCCCACTCACGCGACGCTCCCCTAGCCGCGGTGACGCTTTGCCCACACCGTAGACACGCCG
TGAAGAAGGCTCGCCAGCCCCAGTTGGCTCTCCCAGCCATCGCGATCACGAGCGCCCCGCGCACATGTCTCCTGTGCGCTCGCCGAGCCGTCCACCTGCA
GAGCGCGCTGCGCCGTCGAGGGAGGAGCCGCGACCACCGCCGCGAACTCCGAACCCGTTCCCTGAACGCTCTTCAGGCCTCTAGGAGCTGCGCGCGCTCA
CTGAGCCACGGTATTCGCCACCTCGTGGTGAGGGCGTGCCCCTGGGCCCCGTCATCT