Description :
From Genome Similarity Track
Location :
Scaffold_63:157974- 159803
Transcript NameFunction/comments
Aphas_H257_15095FTO, partial
Aphas_H257_15096Hypothetical protein

Sequence
1829 bases(100 bases per row)
GGACCCGTGTAGTTGGAGGGTACGGGGAGGGGTTTGGCCTTCTCGATCTGTTGTTTCTTGGCTGGAGGCGCGGCACTACTGCCCGATGGCTCACTCGGTC
GCTTGTGGGATGTAGTAGGCTGTGACACAGGCTTCAACGATGCCACATTGGGCTTCTTAGCGCTCTTGCGCTCCAGGGCCTTGGCCTTCTTCTTCTGTCG
CTCAAGCTTCTTCCGTTCCTTCGGGTCCATGGCGATAAGTCGTGGCGCGAATGGTCAAGTGGTGGACAGGAATGTGAATCGCGCATTTTTATTGCACAGG
GTGCCATGCGATAAGAAAAAATTGCAAAAATTATCCTTTTTTTCAGTCAATTTTCACACTTTTTTACGTCCTTTTTAGCCGAAACGTGCACCTGCAGAAC
CACAGCTATCTTAAATACTCGGGCTCGCCTTATGCGATGACTATCTCAGTGTTAAAGTTCACGGGGGTCGGGGCCGGAGGGAAGTTATCCTTGTCGGACG
CAGGTGGAGTCGTCGGGACCGCATGGGGCACCCACGCGTTGCGCCGGCGGACCACAAGCACGACCAGCGCCAGGACGCATGCCGCGGCGACACACCCGAC
GATCACAAAGGCCGTCGTGTACATCTGGTTGAAGGATGCTTCCTTCTTGGCCGACACGTCGCTGGCGTGCACGACAGACGCCACCTGGACGACCGCCGTC
GTGGTCACAGGCACAACAACAACAGTAGTACGCGGCACAGTTGTTGTGGGGGCTCCAGTCGCGGCATGGAGTCTAGTGGTGGTAGGGGATGCCGTGGTGC
GTGGCGCGCTCGTGGTTCGGAACGAATGAGTCGTAGGATGGGGTACCGCCGTCGTCGCCTTGGTTGAATTCAACACTGTCGAATGGACTTGAATGACGTC
GGTCGCGTTGCCCGTGGCGTTGGTCTTCTGCTTGGTGGCGTTGATGGGCGTCCACGTGTTGTTGTTCCCCCCAATCACGTGACTCGATGAATTCGTAGTA
TTCAGCAGCACCACGGGCGAATTCGTGGCATTGTAACCACTGGAATTGGTGGTTGTGTGGTGGCCAGACAGATGGGCAGTCACGCTGGTCGTTGCGTTGA
TGGAGGTGCCCTTATTCACATGCGACGAGTTGACAACGGTACTCGTGTTGGCGTGTTGAACGTGCGGGCTAGTGGCGTTGGTGGCGTGATGGGGCGCGCC
ATGCACAGCGGTGCCGTCGGCGGCAGTGGCATTCCCGGAGCTGACGGAGGTCCCGTTCGAGTGGTTGCTGCCTGTAGATTTAGTCGAGTTTGCGTTTAGA
ATCTGTGAGATGTGCGTGGCGTTGGTTGTGTTGGTTGCATTGCGCACGATCCCCAGTTCGTGATGCGTGATCGGGAACAAGTGATCCCAGTCGACAAAGG
CGGTAGGTGGGGCCACAGTCGACTTGGCCTCGTGGCTGGTGGAAGCGGCGGCTTTAGGGGGCGAGGTTGTCTTGAGTGACAGCGCCGCCGTGAAATTCTG
GCGAGGGTTGAGGCCGTGGGAAGCCGAAGCTGCAGCGCACAGGCCAACGACTACGACCACTCCACTCAGTCCTCGCATACGGTAGGTTGGTCTGGAAAAG
TCAAATGAAAATGGAACCGGCCACCACACGCGGCGAGGTGGCAACGTTCCAGCTGGTTTTAGCAATCGGTACCTCTGGCTACCCGCCCGTACCCATCCAT
ACTAACCGCCCATTCTAGCTAGCACACGCTAAAGAGATTCCTGCAGCATGCTCGGATACTTTGGCCCTAGCATTGTGTTTACTGCACCGTGAGAAACCGG
TGGCTAAAGTCATAGAACGCGGAGCCGGT