Description :
From Genome Similarity Track
Location :
Scaffold_457:15796- 17238
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_457-fgenesh-gene-0.4Serine/threonine protein phosphatase 4 regulatory subunit
Pytir_DAOMBR486maker-pir_contig_457-snap-gene-0.16Centrosomal protein

Sequence
1442 bases(100 bases per row)
GGCATGGGCTGGAGCCCGACGAACAAGAACAAGTCGAGTGAGCGCCGCAACGACATCACAGAGCTGCTCAACACGTTTGAAGGGTGTGTGGCTTTCTATT
GGAATTGTACTACGGGTGTGTCATAAGGCCGACACTAATGCTAGTGAATGGGTGGGTTGCTGTTTGTGCAGTCCGCCATTTACGCTGCAGCGACTGACAG
AAGTGATTCTCGAGCCGCAGAAATCGTACAAGACGCTCAACAAACTCATCAACGCGCTGGAAAAGGTGCGCTATCAGTAATCATACTTGCGCTTTGTGTA
TCGAGACCGACCGCGCGCTAATACTTGATTGGTTCTATATATCCCTACTGTTCTGTAGCTGCTCGCTGTGAGCACAACGATCCAAGTGGCGGACCCTCGA
GCGCCGGCAGGTTTGTCGCCGGACGCTGCAGAGGAGAATGCGATGCAGGCGCCGCTGTCCGTGCAGGTCTTGCAGGGGAATACGGAAGGCGACGTGGTCG
CGCGCGCACCGTGGGGGAGCGCCGAGGCGTCCTCGTGAAGGCTAGCGCGACTGTGATCGGTCCTTCAAGAACTGTGACACGATTCACATTCCTCCCTAAC
ACTCTTCTATTGTTCCTCTACAGAGACCCTGTAGGTATCCATCCATTTATCCAACCCCTCAAAGCTAAGTCTGTAAATGGTTATTGTTGCGTACGCAAGT
GCTAGCCGAATGATCAAATGGCGTTAGGTACTGCTTGTGGACAGATAACTGACGGCAAGCATGGCCCATGTGACTACGATACCCTCCGGGTACGCGAAGC
AGCGCACCGCGAGTCCAAAGTGCGAGGCGCGCGCGTGCAGATCGATGATCCCGGCCGCCAGCTCGTTGGTCTCCAATACGTCCATGGCTTCCTGAACTGA
CTCGACCGTGAACATAACGGGCACGCCCTGGAACGTGTGGCCCTCCTGTACGAAGCGCATGATGCTCTGCTGGAAGAACGCGTTGTCCACCTGCGCGATG
CCGTAGAGCCGCTCCATCTCGTACGCGTTCAGCGCCGGCAGCAGGTAGAAGCTGAGCTCGTCGCTCCAGCGCGTGACGTATCCGCTCTCGCGCCTTCGAG
AGCTGATCTGTCGTCGTAGCGCGAGTGTCCAGTCTCCTTCGATCCCAGGCAACGCCGCGACGTCTGGCGTTTCGAGAGGAATCTTGGGCTGGCCGAAGGG
CAAATCTGCGATCATCTGCTGGTTCATGGGCTTCCACGCGCCGTCGTCGGCCTCAAAGTCGAACGACGTGTTCCTCAGTTTCCAGGTGCGCGGCTGCAAA
TTTGCAAAGAACTGGCGGTCGTTGAAGACGCAGTCGATGGAGCAGTAGCCGTGGCGCCTATAGTAGCTCAAGTCATTTTTGTTCTCGAGCAAGTTGAAGC
GCTCGCCAGTCACAGATTCCCAGAACACAACCTCGCTGAGAC