Description :
From Genome Similarity Track
Location :
Scaffold_63:15794- 18367
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_63-fgenesh-gene-0.6Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_63-fgenesh-gene-0.2Gene of unknown function

Sequence
2573 bases(100 bases per row)
TCTCCGCTCCGGGCGTGAAATACCGCACCACCTCCTTCGGAGCTGTTCGCCAGAGCACCGACTCGTCCCAGGGCAGGAGCAAGCCTGGCTGCACGATAAC
CTCGCACTGCCGAGTGAAATCCCATCCGAGCATTGTCGACGTGGACGCGTACATCTGCTGCAGCTGCCACGCCATCTCGGCGTCCTCTTCGCGCCTTCGT
TGCTGTCTCTGCGGTGGGGTGGGCTCGTCTGCAAACTCATCGTCCGAGCTGTAGTCGAAGTCACGGTCGCCGTCACGGTAGTACTCGTCGTCGGAGATCG
CGTCTTGGTACTGGACATTGACGATATACTTGTCCAATTTTCGCTTCCCCACGACCTGCAGAGAATCACCGCTCACCAGTTTTGGTGTCAACCCTTCTTG
CTGCGGCTGAAAGACTGATGCGTTCGGGTTTAACGACGACGAAGCTCGCTGTCCGTTGGACTCGGTCGACAGGTCTGGTGGGGGATTGATCAGATTGCTG
GCGTCGTTCGGCGATGCATACATTTCGATTGCTAGAGCTGTTCCATCAGCCTCTTCAGAAGTGAGATCGTCGTCTGCAGTCATGTCTCCATCAATGTCCA
TGCTGCAGCTGACTCCAGGTGAATTGCCTGCATCCTGGTCGTTCTTGTCGCAGAGTTGTTCGTGTTCTTGATCTTGATCTTCAAAGTCCTCGGGCTCTGG
TTGATCTGCTGCTTTGCTGATGTCTTTCTTCTTTTTCTTCTTTTTCTTGGACTTTTGATTTGACGAGGACGCCTTGGCTGTTTCTTTGTTCGTCGAGTGG
TCTTTGCGCGTTGGCTTGGAGTCTTCCAGCGACACCTCCAGCAGCAGTTCCTCCATCTGGATCGCGGCTTCTTTCTCCAAGTGGTTCACGTAGCTTTTAA
TAATGAGCTGCTCAGAATCACACAGATAATTTATTAGACCTGACACCCCATAGAGCTACTAAATTTCCGGAGAAACTCACCTGTTCCACGAGCATTGCGA
TGAGGCGCTGGTAGTCTTCCCACGAGTTGATCACCTCGCTCTCGGTCACAAAGAGGTTGTAAAACTGTTTCTCACCGAGCACGTGAATGGAGCTCACGAA
CCCAAAGAGCACGTCACCCACGAGCGTGAAGAGCCGATCCGGGTCTTCCACGAGCTCGCTTTTCACAGTCAATATACCTGCACACAAAAAATCACAAGTC
AGCGATATGCTTCTCATCAACCTTTGGAGAAGTGTATCATGCTCATACCTGTGCCGAGGTCCATGAACTCCATCGCCTCTAGCAGTTCGTAAGTCTTCTC
CGGCTGTGACTCGGTAGCTGGTGCAGGGACTGGTGGCGACTTTGTCTCCAATGTGGTCACCTTCTCAGTTAATGCCGCTTGAATCGTCAAATCTGACTGT
GCACTTGGTGGTGTCACTGCCGCTGCAGCCAATTCTGGTGTTGCGCTCTTCACTGCAGCTACTGGTTTCAGTGGAGTCTTGAGATGTCGCTGCATTAGCC
CCACGCAAAGCAAGCTTAAATTGAGCTTGTAGAGCTGCTTTACGAGATCCGGCTCGTCGATGAACAGGATCTGCTGGCGCTCGTTTCCGCTGAGCTGCTC
CCAGTATTTCCGGATCCGCGGCGCGACCGACGAGCTCTCATCCGCAAATCGGTCATGCGCTTGCGCCGGCATCGCCATCCAAGTCGAGTTGCTGCCAGCG
CCTCCAGCGTAAGCGTTGGTCGGCTTGGATCGCTTCCTGGATCGCGCATGCGTCGTCAACGCGCCGCTGTGTAGCTGCAGCCGCCAGCTCGCACTGCCGC
TCGCGGAGATCTCCGTGCGCACAGCCAGATAGTTCTTCCATATCGGCGCTGCACCAATGATAGAGGGCATCTTGTGAGCAATGTGCACACACGACCATGC
AAATGCAATTGCACGACGACGAGCAGCTACGCAATTATCGCCGTCAATGCGCGAAGCCCGTGACTGCCATGCAAACACGCACATAGCACCCCATGCGTAT
ATGCAATATGCTCCCCACCTTCTATCGCTGCTGCGGGCTTCTTGGTCGCCACTGCGCTGCTGCGCGCCGCCATGCCTCTCACTTGTGCGTGTGAGATTCC
CCAAATGGACTCGTGCCGCCATCCATTTGCACCTTTTCGTGTGTTTTTAACCAACTTTGTCTTCCCGGTCATCAAATAGTGCCACAGTTGTTCTAGATAT
GCAACAGAAACTGACTTCCAGGAAGTAAATTCCCCTTTTTCGTTTCCGCATTTCCGAGAGAGTGACGCGATGGCGGATGTCCAGCACCGGCGCATCGCGC
AGAAGCTCAAGGAGGCGTGCGAGGAGACGGCGCAGCAGGCGATCGCCGCCACGACCGCGAGTGGACAGGCCTCGCGCGTGCACCACAAGAACCGAAAGTT
CGCCAGTCGCAAGGACGCCATGGCCGCCAAGGTGAGCGAGTGTGGTGTGTTATGTATGCACCAAGCTAGTTGCCAGCCAGCAAGCTCTGAATGTGGTGCC
CTTTGTGGTATGTCTGTGTGCTACTTATGTCAGATCGCAGCTGCCAAGGCGAAACGCGGCGAGGAGAAAGACG