Description :
From Genome Similarity Track
Location :
Scaffold_305:1579- 2855
Transcript NameFunction/comments
g4838.t1hypothetical protein

Sequence
1276 bases(100 bases per row)
CAACCACGAAGGCCGACGCCACGAGGGCGATGGACATGGCCACCGAGGTGGCGTCGCTTGAGGATGAGTCGCTGCTCTTCTTGTCGCTCGACTTGCTGCT
GCTGGACGCGACCTTGCGCGTGCACTGGTCGCCAGCGTAGCCGCTCTCGCACTCGCACACGTTGCCAGAACCTGAGCCCGAGGACGAGGCCATACCCACC
ATTTCCATGAGGAATCGGGCGGACGAGCCCGAGCCAGCAGCCTCCACCGTGCCAGCACTGGCCGTGGAGCCCGTCGACGATCCGGACGTGGTAGCGGACG
AGCCCGAGGCCGAGGCCGAAGCGGCGACGCACGTGCCCTTGCCGTTGCAAGCCTTGGACGACGTGGGGTCGCAGTAAGCGCACTGGTCGCCAGTGGTGCC
CGCATCACACTCGCACTCCTGCGTCTTGAGGTTGCACGTGCCGGCCTGACACTGGGACTCGAGCGTGCACTTGTTGGACACGACCTTCTGGCAGTAGGTT
CCGTTGTAGCCCACGTTGCACTCGCAGTAGTAGTCCATGGAGCCCGAGGAGACGGGCGCGCACGTGCCGCGGCCCGAGCACACGACGTCCGAGTCGTCGG
CGTTGTTGGGGTTCGTGCAGCCATCGTTGATGACGGCCGTCGTGTTCATCTGCTCCGACATGAGCCAGTTGTCCGAGTCCTCCTCGAAGAGCAGGTTGGT
GCCGTCGAAGTCCACGCAGCCGTAGATCACGCCAATGCTCTCGGCCGTCGAGCCCGATCCCTCGGTGATGTCCATGCACGACACGTAGCCGGCCGTGTCC
GAGCCCGAGAACGAGCCGTTGAGGCACTGGTCCGTGCCCGACGGCAGCTGGTACGCGCACACGCTGCTGATAGACTGGAAGGCCGTGTCCCACGTCGAGA
AGGACGGGCACAGGCCCGGGAACGTGCCCGAGCACACGTCGCCCTCGCTGCTGTACGGCAGGCACTGCTTGACGTCTTCGATGCCCGAGCGCGTCGTCTG
CACGCTCACGCACACGTAGTTGGCCTCGCACGACGTGTCGTCCTTGCAGTAGCCGGCCTGACCCGAGCCGGACTCGGCCTTGGCGCCCGCGAGCAGGGCC
GCAATGGCCGCAATATACGCCGCTGACTGCATCTTTGGGAGCTCTTGAGTCTCTTTGGTAGCAAAAGAGGGAATGGCGCAGAGGTGCGGGAGACTTCGAA
GAGCCGGCCGGGGGAGAGGGGTCGTCGTCCCGTTGTGCTTGGCATTGACTTGCGCTTTGTATGTGGGAGGAAATTT