Description :
From Genome Similarity Track
Location :
scaffold_418:1579- 2678
Transcript NameFunction/comments
g8175.t1 hypothetical protein PHYSODRAFT_258180

Sequence
1099 bases(100 bases per row)
CCAGGGTGCAGACCAAGGAAGCCAGGACTGGGCTCTCCCTGCACTTCGCCAAAGTACAGAGCGAACGTCTGCTTCCACTGCTCCACCTTCGCTCGGTCCT
CCATGAACGTTGGGAAGGACGCCATGTTGGCCTCCGGAACGTCCCAAGGTTTGTTGGCGTTGATGTCCGTGCGCACACTGTTGAACACCACCGTCGTCTG
GGCTTCCTGGGAAATAGCCCAGTTCATGAACAGCTTGGCGGCAGCAGGATGCTTGGCCTTTTTCAAAATAGCAACACGTTGACCCCAGCTCAGGTAATCG
GTGCCATTTCCTCCCACGAACACTATCGGGTCGCTGGTACCGCCGAGGGCTCCCACACCAATCAGTTTCTCTCCAGAGCTGACAAGTTCACCAGCGACAT
TAGAGCCACGGTTGAAGCTGACGTTCTGCTGAGCAAGTTTGGCCACCCAGTCCCATCCGTATTTTTCCACGTAGCGAATGTACAAGAACAGCACAGCGTC
ATCGTCGTGCGGGTAGGACGACGAGATCTTGCTGGCTCATTTTGGGTCCGTCACATCCGCTGGAGTAGCAGGCGGCGCCACACCATCGAATGCGGTCGAG
TTGTAGATGTAGCCGAAGCTGAAGATGGAGTACGCCAACCACGCACCATCCATGTCCTTCAACGAGTTGTGGATCTTGGAGAAGTTGGCAGGTTTGTACG
ACAGGAGATCGCCATTCTTGGCCCAACGGGTGAAGTCCTGCAGTGTCTGGAGCGACACCACATCGGGGACCAGAGTGTCCGTCTCCAACTGGTTGTCGAT
ACGCACGTCGTGGTACTTGCTGTAGTCAACAATGGCAGTGAAGTTGATCTTGGGGAAGCGCTGCGTAAATGCGTCGTGCAGACCATTTTGTTGTGTTGGG
ATGTCTCCTCCATGGTAGAGGACGAGGTTACCACCTTCTGCCACGGCGTCAGCGTAGGTTTGGTCGATGGTCTTGGTCTCCTCGCCAGATTTGGCTATGA
CGCCAGAGGAGAAGATAGTGCAAACAAACAGGAGCGGAGCAAAGAGCTGCATGGTTTGTAGTTAACGGCTTTTGCAGGAGGCAGACAATTTGGGAATGA