Description :
From Genome Similarity Track
Location :
Scaffold_21:157814- 159473
Transcript NameFunction/comments
Phyke_g1392hypothetical protein

Sequence
1659 bases(100 bases per row)
CGACAACGGAACCTTATTGCGTCGTACGAACAAGGATACCAACCGAGTTGATAAGTGGGAGAATGGCAATGAGGGCAATCTACTGACCAAGCCTTGCACT
CATACATTGAACATGTCgatctcctcttcctcctcgccAGTATTCGCCAGTGAGTCAGTGGTTGACTTTGCAACAGCTTGTTGTATTTGGGCCTTGGATT
TCCATCCGAATTGTACGACCGTAGCTGTTAGGTTGTCAGCGCTATTCTTCTGGTAAGCAGCTTTCACGATCGCATCAGCTGCGGCTTTTGCATCGTGAAA
GTGCGGCAGAGCGATATCCACCACTTCTTGCTCGGTCAATACGTCCCAGATACCATCGCAGCCCAACACAAGAAACAGATCATCATCTTCTACTTGGAAC
CGCTTCACCTCTGGCTCATACGAGACGAGTGGTGTCGGAACCTTAAGTGCGCGATCACCGAACGCGCGTGATACAGCGAGGTATTTGGAACTCCCCTGCT
GCAAGGCCAATCCGGCACCCGCAGCAGAGTACACCCGCGAGATACCTGCTAATTTGCCCACAAAGCCGCCAGCTTTTTCAATCCGTTGTCTTTCGTCTGG
TCGATCGGGCTTGTGGTCACTAGTAAGCGGTACGCCTCGACCTCCACGGCACACCACAGCGCGGCAGTCGCCTACATTTACGGTGTAGAAGCTCAACTCG
CCTGCTGACTGCTTGTCTTCAGCTCCCGTACCAGTTTCAACTTCGCCAGCGATAAACCAAATTAGCAGTGCTGTAGAGCCATCCTGGGTTGGGTTCTTCT
GCATAAGCTGGGTGTCGACTCGCTCGAAGCCTTCCGAGAATGCCTTCAAGAAGTGGTTATGATGCTTATTGCACCAGTTCTGTCGGTCCACTCGGCGTAT
AATTTCTTCGGCATCAATTTGCTTGACTTCACGCTGCATCTCAGCGATGGCAACCGTCAGTTGATCTTCAAGGACCTGTAGTTCATCTGTAGCATCGGTC
TCCGCCCCACGATCGGATCTGTCTGGTGCTCGAATTGTGTTGATTTCCACTAGCTGCTGATTTAACGACTCAAAATGCTTTTTAATCGCACACTTCCGTT
CGCTCTCTTGATGCGAAAGCTCTTGTGAACTGCAGAAGTCATTTAGCGCTCTATCGCCAATATTCTGGCGGATAGCTGATGCCACGGTCTTCACTAGTTG
CCGAGTTAGAAAATTCGCTGAAAATGTCCCTCCATGACCGTCGAAAATGCCAAACACCGGACCAGGAAAGTGCTCGACAGAGGTGACGTGACGGTCTTCG
TTGGTGGTCTTCATCCCAGCCCAAGATTCGGTCGCAAAGCGTAGTCCAAGGATCGCAAATTCCTTTGGTTGATCCCGCTCTAGTCTCACGGCCTCGTTGT
GCGTGCGGTTCGCTTTGAGCCCCTTCttttcatcgccaccatgaAGCCTTCGCTTGGACATCACGTCTGACCTCAGGAAGATATGACGCGTCGTTTCTAT
ACGTACACGGACACCAGAAAATGATTGGACGGGTCTCGGCCAATGTTGTGTTTAGTGATATGACCTCTAAGATGAAATCCATCACGACAAGTAACGCGTG
GCAATGGATTTTGTATGACAGACAATACTACTCGACGTGGTGAAGTTGGAGTCCTGAGG