Description :
From Genome Similarity Track
Location :
contig_51:157790- 159210
Transcript NameFunction/comments
g10585.t1hypothetical protein

Sequence
1420 bases(100 bases per row)
ACTCCGCAAAGAAGGAGAGCCAGCGGGCCATCCTCTGCGAGAGGTGAGGCGACTGAGTCGCAGTGCGTAGTGACGCATGATCAGTAAAGATGACAAATGG
CTTAGAGCCTAGCAGGTGAACCCTGAATTTGACTAGAGCATACTTCATTGCAAGTAGCTCCTTGTCATGAACTGGATAGTTCTTCTCTGCAGCTTTAAGC
TGGCGAGACTCAAACGCAATTACGCGTTCACGCCCTTCGGTGTCTGCTTGCAGCAGTGCACAACCGATGGCAAAGTCCGATGCGTCACAGACGACACTAA
ACGGACGATCGGGGTCTGGCAACGCCAGGATCGGCGCGTGTAGGAGACTCTCCTTAACCGCCTCGAAGGCAACTTGATGCTCGGTGTCCCAGGCCCACTC
CACATCCTTCTTAAGGAGATTGGACAATGGCCGAGCCATATCAGCGTAGTTCTCGCTGTACTTATGCAAATAGTTGGCGAGGCCAAGCCACTTGCGTAAG
TCTTTTTGGTTCTTGGGAACCGGCCAGTCAACAATGGCTTTGACCTTAGAGGGATCCGCTCGAAGGCCGCGCTTCCCGATGAAGCACCCTAAGAAGGGGA
TCTCTTCAGCACCGAAGATGCATTTGGATGCGTTAGCGTACAGCTTATTAGTGCGCATGCACTCGAGCACCGCTCGCAAATGGTCTATGTGGTTGTCCAC
ATCTGACTTCCCGTGCTCGGCACGACTGTGGACGAAAATGTCGTCGAAGTATGTCTGTGCATACGCCCGATGGGGCCGGAAGAGCTGCGTCACTAGACGA
TTGAACGTCGCGGGCGCGTTCGACAGCCCCTGGGGCATCACCAACCACTCCCAGAGCATCCCGCTCGGGGTGCTGACCGCTGTCAGCGGAATGTCGCTCG
CACGCATGAGCAACTGGTAATAACCATCGACTAAGTCGAGCGCACTGTATGCTGTGCATCCAACCATGTTGTTCTGGAGAACATCCTTCCTAGGAATAGG
CGTCTGCGCCGGAATGGTGGCGGCATTGAGCTTATTGAAAGCGTGGACAATGCGCCACTTGCCGTTTGACTTTCTGACACAGAATGTCGGCGTCGAGTGC
GGAGACTTGCTCTCGCGCACCATGCCCGCCTCGTGTTTCGCACGGAAGAACGCGTCAATGACGTCACACTGCTCCCTTGGCAAGGGCCACTGCCTTGTTA
CGCAGTATTTGGTTCCAGGGACCAGGTCAATCTCATGACGCACGCCTCGATCTGGAGGTAGGCCAGAAGGCGGATCGTTGGAAACGACATCTTGGTATTC
CTTAACCAAGGGATAGTACGGATCTGAAGGATCCTTCAGGATCGCCGATCCACTACGCGCACTAAGCGCCTGCTTCGTGTGTTTCATCCATAAGGGACGA
CGAGTTCAACTCATCTTCAG