Description :
From Genome Similarity Track
Location :
Scaffold_13:1577712- 1582399
Sequence
4687 bases(100 bases per row)
GTGTAAGCACGTAACGGGCTGCAGTTAGCCCGTTACACCTGGTAGCACTTCGCTAATCCGTCCAACGCCCAAGATCGTGATGAACATGAACGACACGTCG
ATGTCTGACGCGCCCCGGACGACTGCCACTTCACTGAAGCACACCAGCTTTCCTCACCTGTCGGCGATCGAGTGGGAGGCGCTACACCGCCTCGCAGCGG
TGTCTGGTGACGCTGTGATCAAGACACTGCTGACGGCGGGAACCGAGGAGCAACAACGCCTGGCCGCGCAGGAGTTCATGGCGCGTGAGCTCGCTGACCT
CCGTCAGCGAGTGGCGACTCCCACGCAGACCAAGAACAAGTCCGACATCGTGAAGCTCGATGTCTCCAGGTACAGCGGTGAAGGCGAGGGCCGCCTTCAC
CTGAACCGCTGGTTCTGCGAGGTGGACATCGCGATCGAAGCTCGGCAGCTGTCTACCGAGCTCGCGCGCACGCGCTTTCTCCTGTCCAAGCTGGCGGGGA
AGGCGAAGGAGTGGGCGCTCGGCAAGCTCGTGGCCGACGCTTCCTGCTTCCCGACCATGGCATCGATGAAGGCGGACTTGCGGCTCGCGTACGAGCCGCC
CCAAGATGAAAGCGTTCAGTGCTCCGCCTTCCTGGCGTTGAAGCAAGGACGCATGTCCATGCTTGAGTACATCCAGCGCGCACGACACCTTGTGTCGTGC
ATCACGACCCATCCCGTAGACATGGCGACCCAAGTCCACGTCTTCATCTCCGGCATGAGCGCTGGCTACCAGCGCATCTACCTGACCCGGAAGACCCCAG
CGACACTCGAAGAGGCCTTCGCTGTTGCGCTCCGTGAAGACTACAGTGTGACGGCGTCGCAGGCTTTCGATGTCTCTCGGGCTCCGGTGCCCGAGCCGGA
GCCGATGGAGGTGGATGCGATTCAACAGTTCGGTGGACGTCGGGTGTCGACGTCATCAGCAAGGCCGCCAACGGCCTCGTCAACGCGCAGTCCCCGCCCG
ATGCGCTGCTACCGCTGTGGGAAACCTGGACATCGCGCGGCTATTTGCCGCGCTCCGGCGCCGATGCAGGCGAACGTCACGGTCGCGAACGACATCGCCG
CTCCAAAAAACGGCGACAACCAGTTGGTGCGGAGCGCCCTACTGGTCGTGGAAGGAGCGATGGTTCTCTGGTGGCAGAACCTCCTCCTAGCCCTCCCGTG
CTTCATGCACAACTCTTTGCCACCACCTCCGGCAGTGACACGAGGCTGATTGTGCTCAGCCTCCACGTGGACGGCGCGATGCGCCCCCTTCGCGCGCTGC
TGGACTCGGGCGCGACGAACAACTTCGTTCGCGCCGAGAGCTTGTCGGTGTTACCGGCGCACATGAACATTCGCGACGGGCCTGGCGACATGATCGTGAA
GTACGCTGATGGGAAGCCGCGGCGCTCGGCGACCTTCGCGTACGAGTTCGACGGGTTCCGAAGTTCCGAGGAGTTCTTGGTGATTGAGCTGAGCGGTTCG
TTCGACTGTGTCTTCGGCATCCCGTGGCTCGCTCGCCACCAGCCTGAGATCAACTGGCTGACTGGCACAGTCCGCCCCCGAGACATTGATGTGAATGCAG
TATTGGCGCTCCTGTGCGGAACGCCTAACCAGTGGCCGCATGTTGCCGTCATGGACCCCGCCTCCATGACCCATGCTGTGCACGATGCGAGCGATGGCCC
TTCGTGTGCGGTGTGCGAACTCGCAACCTGCGCCGGTCCTGAGCAGGAGCCTCAGGACGTGTCTGACGTGGTCGAGCATGGGTTCCCACGTCCCGATGAG
CAGCGGTTCTCGGAAGCAGACAATGACGTGATCGAGCCACGTCAGGACGAGCAGCGGCTCTCCAACGTTGAAGAGCGAAAATATGTGGTTGAGCGTGGTC
TCCCACGCGCGGTCGAGCATGGGTTCCCGCGTGTGGTCGAGCGGGAGCTCCCTGATGAAGTCGACGCGGTCGTGTCCAATGACCCGCGTCCAGGCGCCGA
CGTTGTGTCCCGGCGCCCCAGTTCAGCGGCCGTGATCGAGCATGGGCTCTCATCGGCACCTTCGGACAACACTCCACGTCCGGTTCGACGTCGCGGACGT
CGCAACCCGCGCCGTCCTCGTACGCCCTCGGCGGACTCGGTTGAGGCTGAGGCTGAAGTGATCTCAGTCCTGGTGGGGGACGACGCGGAGGCGGCTCCGC
GTGTACGCGACGTCGAAGTCGCATGTCCACCGTGCGATGCCGCCGAGATGACTCGGCTGCCTGGGCTCTTGTGGAAACACTTCCTCCGTGACCTGAAGAA
GGGCAAGATCGAGCAGGTGTGCATGATCGTCGCCGAGGACGCCGAGTCAATTGCGGCCGTCGCAACCAGTGCGTCGGACCCAGCTTCCGACGCCAGGACG
CGCCCAAAAGGAGCCGAGCCGAAGAACGCCCGTCAAGCCCGCTACGCAGCTCAGTCGTTGCCGGCGCTCGAAGCGGCCGGCAACCTAGTCGCGCCGCTCG
TGCGCGAGTTCATGGAGATTTTCCCGGACAAGGTTCCAGCCGTTCTTCCACCCGACCGCGGGGTTCGGCACGAGATTGACCTCGTGCCCGGTGCGAAGTA
CTGCGTGACGCGGCAGTGGCCGCTTCCTCGCGACCGAGTCGAAGCCATTGACGCCTTCTTCGAGAGTCGCCGGCAAGCCGGCCACGTTCACGAGAGTCTC
TCGCCGCACTCTAGTCCGACGTTCTGCGTGAAGAAAGCAACCGGCGGCTGGAGAATCGTCCACGCCTTCAACAAGCTCAACGAGGCCACCATACCGGCGC
AAACGCCGATCCCGAGGAAGGACATGGTGCTGGACACCATTTCTGGCAGCACGAAGTACAGTGCCATTGATCTGATGGATGGCTTCCATCAGATCCTGAT
GCGCGAAGATGATGTGCCGCTGACAGCGGTCAGCACGATGTTGTGGGAATGGCTCGTGATGCCGCAGGGGCTCAAGAACGCCCCCGCCACCTTCAACCGG
ATGGTGTCCAACTTGCTTCGGCCGTACCGAGACTTCGCGCCCAGCTACTTCGACGACATCTTCATTCACAGTCGTGCCGAGGAGGGCATGACGGACGTTG
AGGTCCACCTACAACACCTGCGCAAGGTGTTCGAGGTGATGAAGGAGAACAAGCTGTACGCCAACTTGAAGAAGTGCATCTTCTGCGCTCCCGAGATCCC
TGTGCTCGGGAGCTACGTCAGCAAGGACGGTGTCCGCGCCGACCCCGAGAAGATCGAGGCCATCTGCGCGTGGCCGACGCCGCAGGACCAGAAGCAGCTC
CGGCAGTGGCTGGGGCTTGCCACGTATCTTCACCATTACTCGAAGAACTTCGCTTCGACGATCCGCCCGCTATCTCAACTACTCAAGGCAGACGCCACGT
GGTCGTGGCGTCCCGAGCACCAAGCTGCCTTCGACGCGGTGAAGTCGAGCTTGTCCACCGCGCCGAAGCCCTTCCATGTCGTGTGCGACGCGAGCGACTT
CGCGATCGGATGCGCCTTGATGCAGTTCGATGACGAAGGGTGCGAGCGGGTCATCAGCTACCAGTCGCGTCAGCTGAAGCCGGCGGAACGGAATTATCCG
GTCCATGATAAGGAGCTGCTGGCCATGCGCTACGCCCTCATCAAGTACCGCGTGTATCTCCTCGGCGAGCAGACCTTCGCGATCTACACCGATCACGCGT
CGTTGAGGACAGCGACGAAGAGCCCCCACTTGTCCCAGCGCGTGGCCCTGGTTGTCCCTGTTCTCCGAGTACAACTTCGTCGTGCACTACAAGCCGGGCA
AGACCAACATCCTTGCCGACGCGTTATCGTGTCGGCCTGACTACGTGCAGTCAGGTCGCCACGCAGTTGGCGACGAGGACGACGACGAATGCGCCGTATG
CACTGCCGAAGACGTCGCTGCTGTTGAGGTTGCAGCGACCAGTCCGCTCCGCGACTTGATCATGGACGCGTACAAGGAGGACGCGTCCTGCTTGGAGCTG
ATCCAGTTCCTGCGAGACCCTGGTGCCGTGGCGAAGCGCAAGCTGTCTCCACGCAGCCGCTCCCGCGTCGACCGCTACTCGCTGGACGGCGAGTTGCTCA
CGTACCGCGTCGACCGTGAAGACCCCCCGCGCATCGTCGTTCCTCTGGACGACGATCTCCGAGCTCGGCTGATCCACGAGTTCCACGACACGCCGAGCGG
TGGCCACCTCGGACTCGAGAAGACGTTCGCGTCGCTGTCCAGAGACTTCTACTGGCCGCATATGTACAAGTGGGTCCGGAAATGGGTACGCTCCTGCGAA
GCGTGCCAACGCGTGAAGCCGAATCCGTCCAAGCAGGCTCCGCTACGACATCTCCCAGTTGCCACAGACGCATGGGCGTCTGTCAGCATGGACTTCGTCT
TCGGGCTGCCCCGAGACACTCAAGGGCGCACTGGCGTGCTGGGGACGCGGCTGTGCATGTCCACCGCGTCGCATCCGGAGACGGACGGCCAAACTGAGCG
CGCCAACCGTGTTGTTGAAGACATACTACGCAGCTTCGCTACGTCGTTCAAGTCGTGGAGCACCTTCCTGTCCCTGGTCGAATTCGCCCTCAACAACGCT
GTCCACGCATCGACCGGGCTGTCCCCGTTCTTCGTCAACTTCGGTCGCCATCCTCGCGTTCCAGCGCTCCTTGGTGTGGAGCGCCCT