Description :
From Genome Similarity Track
Location :
Scaffold_6:157771- 193461
Transcript NameFunction/comments
Phyta_totarag476hypothetical protein PHYSODRAFT_552348
Phyta_totarag477hypothetical protein
Phyta_totarag478conserved hypothetical protein
Phyta_totarag479hypothetical protein PHYSODRAFT_469149
Phyta_totarag480hypothetical protein PHYSODRAFT_294124
Phyta_totarag481hypothetical protein
Phyta_totarag482conserved hypothetical protein
Phyta_totarag483conserved hypothetical protein
Phyta_totarag484hypothetical protein PHYSODRAFT_475141
Phyta_totarag485tRNA (guanineN(7))methyltransferase putative
Phyta_totarag486hypothetical protein PHYSODRAFT_552333

Sequence
35690 bases(100 bases per row)
TCCCGGATATTAACCCACAAAAAATGCGACAAGCGCGTTCGGATACATACTAAAATCAAGTCACTCCCGATATCCCTAGATCTTCAAAGCCATATCTTCT
GCCATTTTCGAAGCAGCCAGGTATCCCTCAAGTCTCCGCTAAACCAGGATATCCCCGTCCACACTCTGAACCCGCGGTACCATCACAATGTCGTACTCGC
TGTTCCCCCCTGCGGCCCCCTGTGCTCCGTCAGGATCcgctccaccgccgccgcttTTTCGATCGACTGGGgacctgcagaagctcatTTCTCCCCATTT
CCTGTCCCCCGAAGCTCGATTGAGACCTGTTCCCACCAACGAATGGTGGGGCAACTTGCTGGCGTGGGACGGACAACGGGACAGCGACGCTGTGTTCGCT
GGCCCGTATACTTACAAAGTGGTGCTGGGCCAACCCGGTGCCATTGGCAGCGGCTTGTCAGTCAGctacttgctgcagtaccgAACGGACGGCCCCATCA
ATGATAACGGAGCTCCACGCTTCTACTTCTACCCGCCGACCATCAAGAACTGGATCTTCTCAGCTGTGGAGCTCGCGGACCAATCGGGTGCACCGCCTCT
TACCATCGAAACTTGGGACGACATGGGGGTGCACCTTGCCATGTCAGGGATGAGGATGTACTTGGCCTTGGGCTCTGCCTTCACGACGGTGGAGTACCAG
GGCATGCAGGTGCAACTTGGTACGGAACATTCCATTGTCGCTATCAACGGAGCTCCTGCGAGAGAAGGCCACCAGGTGAATGGGATCAGCTTTGTGGTCT
CACTCAACAACGGACAGCAGTGGGTGCTCTACTTCTTCTCCAATGTTGGCGGGAACACCTCGCTGGTGTTCCAGGACAACAAACTCACGACCACATCAAA
GTTCACGGGAGTTGTCCAGGCAGCGTTCGTCTCGACGAGTTCAGTGCAGCCTGCGGTACCTCAGGACGACCACAAAATTCTGCAACTTTACCACGCAAGT
GCAGGTGTCTACCCTACAGGAGCCACCGTTCAGACGCTGAACTCGGAGTCGTTTACCTTCCACTGGCAACTTACAACTGCTGCAGGCAGCAACCCGGGAG
CTCGCTTCCTTCATTTCGCACTCACACACCTGCAAGCAATGCTGGATCCCTCTACAGTGGAAGCCAAACACGAACTCGTGCTGCATTCGCACACACACGG
GCCGTTGTTTGCGTATATGTTGGTGGCTCAGCCAAATTCCAATCCGACGTGGCTTTGCAACGTGCCCCAGGCTGAAAGTCAGGGTGTCGAGACGTGCACA
GTGTTTTACCCACCGCGCGCTGGGTCCCTCACCCGagaggaggtggagaggCTGAACTTGTgtcgcgtcgtcgccgatgaAATCCACGGAGATTGGTCTT
TGCCGCGTGAAGGAAGCTACTACTTTAAGGGCAAGTTACTGCAGAAGTTTGGCACGATGTGTCTTGTGGCGCGGCAGCTTGCAGACACTACTAACCCTGA
AATGAAAGACGTGGCGCAACACGGCAgttccaagctgcagcaactgctgtcGGAGTTTGCGAACAATCAGTCGGCGTTCCCACTTGTCTACGACACGGTT
TACAAGGGAATTATCTCAAGCGAGGCATTGGCTAAGAACGACATGAATGTCGACTTCGGCAATGGCGTGTACAATGACCATCACTACCACTACGGCTACA
TagtgactgctgctgccatggcCCTCTACTTGGATCCGAATTGGCGTCACTCAGCCGATGCCGTCAAGGTTCGAACGCTCGTTGACACTCTCATCCGAGA
CGTGGCTACATCGTCACCTACCGGCAGCGATCCGTATTTCCCGCGCTTCCGATACTACAACTGGTGGCTCGGCCACTCGTACTCACATGGTGTGACCCCA
ATGGCCGATGGTAAGGATGAGGAGTCTACATCAGAAGAGGTCAACTTTCTGTATGGCATTGCTCTGTACGGCCAAGTCACGGAGAATGCAGAACAACAGG
CGCTGGCAAAGTTGATGCTCAAGGTCTACGTGCGCGCTGTAAACACCTACTTCTTGCTACGGAACGACGGTCCTCCTATCCACCCCGCGGGCTTCGCGAA
GAACAAGGTCACGGGCGTTTTCTTTGACAACAAGTGCGACTACGCAACGTGGTTTAGCCCCAACAAGGAGTGCATTCATGGCATCCAAATGATCCCCGTG
TCTCCGATCCTCGAAGTCTCCCGACCGCCACGCTTCGTACGTGAGGAATGGGATGAAGTGCTAAGCAGACTGCCCATTGTGCACGACTGGAAGGCGAACC
AGTCTGGCTGGACGTCGCTATTGTTTGCCAACTACAGCGTCTTGGACCGCGCAAAGGCTTTCGAAGTACTAGCCATGTGCCCCATGGATGACGGTCTCAG
TCGCGCCTGGGCGCTGTACTATGCTGCCACTCGcccgccaccttcttgttaAGCTAAGCCAAGACTCCCGTGCAGCTGGAAAGTCTCAGTTCTGGACTCC
AATGCTTTCGTGTTAACGCACCCCTCTATTTGTTGATCAACACGTTCACCATTTCAATTTGCCCATTACCAATACTCTGGGTGTTGTCCCTATTACGGAG
GAGTCATCGCTTGTAACAACGATTGAGCCAGCTCACTTACCACAGGTGATACTTGCCGATCGCGTACCGTGATCAAACACCTGCGAAGTCAAAATCATAA
GACACTTCAGTCTCTGTCAGCACTGAATTTTGCCAGGGTTATCGTACCTGTCGATGAGCCGCTGGAGTTCAACTGGTGGCAACGTCCCCACAAAAGCCGG
GAACTTTCCAATGAGAGCTCCAACCACTTTAAGGCCGTTCATTGCTACAGATTCACTTCGCGTAGACTCGAgacgagctgcagtggcctCGAAACAAGTG
CGAACAAGTTGTAGATCGCCGTTGTCTTCCATTGAGAGGATCCCGCTAGCCTTGTACAAAAATGAAAAGATGATCTACAGCAGGTTCAAACCACAAAGTA
CAATGGCTGTCAGTCAAGCAACCTGGAATGGCTACCAGAAAAATCGGTCTCTACAGTACCTGGAGACCTCCAGCAACTACATCTTCTTCAGAGCAGCTAT
CGGTTGCTAATACAACGCGCGAAATGAACCCCTGCGTTTTCCAGCTTGCGAGAACATTGTTCTCCGAGCGTGAGATGGCACTACAAATACAAGTCAATAC
GCGGTGTCGATGGAAACGTCTTCTCTTGCTGACTGAAGCACATACAACAGAAATCAAACGCACCTGAGTAGAATATTACAACAGCATATGCGAACTTGGA
GCAGTAACTCGTGATTCTGAGCTTCACTCCACATGTCTTCGAGCAATTCCTGCGCTCGTGAGTAGAGAGTTTTAGTGTCCCGATCCGTAATGCTGTCTTT
CCCATTCTTGGTCCCGAATATCCATGCCATCAAAAGGTCCACTAGTGATGAAGCACTCGCTGTGGGCACTTTCGTGCTACCTTGTCCGCCGTCATTCGCT
GTCAGTCTGACGAGTACCAACGCGATGCAATCAATGCAACCACGTTGGAGATCAGTAAGGAGTGATTCATCCGGTGCCAACCTTGAATTTTGAACGCACG
GAATTCCCAGAATTTGTACCAGCACGACAAGTACTTTCGAAGTCATCTCTCCATCTCTGTAGGCATGCGCATCCTCGGAAAATACCCGATTTAAGTAGTA
GACCATCAGTTTGGCCGTCACCAGTCCACACGAATTCGGAATGCTTTCCTCGTCCACAACAAGCGAGCTACCTCGTTGGTCATGTGGAGTTGCTTCCCGC
AAGAAAGCAACCAAGTATGCGAGGACGAACGGCAGCACTCGAGGTGGAGGGAATTTGGATAGGCACTCAGTAGCGACCATCTTCACTTCTTTGAATTCCA
GTGGGTCCACTACTGATCGGGCTAGGATGTGAAAGAGAGTTTTGCTTGTGATGCCCACCTTATCATGAGAGAATGACTCTGAATCGCTGAGGTtaagctg
aagctggcggtCAATATACTCATTCAGATGATTCAAATCTTCGAGTCCACACTACACCATACACACAACCACGCAATCAAGTCATCAACTGAAAGAAGAA
AGAAACCTGTTACGAGGCTACGTACCAGCAATGACTTGATACGATTAGCTCCAAGAACATTTCGAGGAAGCATTCGTAGCACCAGTAGCGGTGCTAACCG
AGAAAACAGCAACCCCTCAATTGCTTTTGCCGCTGAGAATGAATTGTCGTCCAGAAACTCTTCACTCAAACGCGGAAGATTCTGCAACAGCCATGGCATC
AAACACACAGATTAGCATTATCTATAATGATTTGGTGCAGTGTGGCCCAACACTTACCATCATATGAGCGGAGAGCTGTTTCCCCATCATTTCAAATACG
TCATGGTCCACCCAGCCGCATCCAATAAATTCACGCAGCATCCGCAAAAGCACCGGGTCACGAGGAGACCCAAAGATTTTGCGGAGCAAGACACGTAAAA
CTTCACTGCGAGCACTGGACTGTTGAACACGCTTATTCCACCTACGCATCCACGATACGGATTATATTCCCGTTAAAGGGAACACCTGAGACTTTCATCA
CTGCAGTACTTTGAAGTAGTATAATAACGTACCCGTTTGGACCGAAACAAAACGAAAACAACTTTTCTTGCGTCTCTTTCcgttcatcatcatcagcaAT
GTTTCCTTTGATACCTCCCTCCAGCTGGGTAACGTAGCCGTCCCATTCGCGAGGGGATGCTGGTAACTTATCAGAAATCGAATGGACTCGAACACTTCCG
AACTGACAAGCATCAATGTACCACGATACCATGATTTCAAGGTAATACCGCGTCGTAGACGCGAAAAAATACCCGAGTGTCGTTGTAATAATGTGCTTTT
CGGCATCGAAGATACCGGCTGTACACAATCCCGCAATGCAAGACACAACGTCTAGTGACGGCAAGCAAGAAACAGCCTAAAGAAAAAAGGTACAGCGTCA
GTCATCGCATTAGTAGACGGAATCGATGTCATGCATTACAGTAAGTTGTACCAATCGATGGCGACTGTGGTTTTCGTGGGCAATGAGACCTAAAACCTCC
GGTGTAAGCACCTTGCTGTTGACGAACAAAAGGCAAAGTACGCAGTCATTGTCAGATTAACATTCACTTCATCAAAACAAAGAAGAACATATCCTTTTCT
CTGTGATAAGTTCTCACCGCCAATGCCGGTGTAGTAGAGTTTCAGTAGTTGCACTGTCCAGTTGGTATAAGAATGTCCGCACGAGGGAGATAACACTCTA
CGCAATAACGCACAAAACACACGACAAGGCAAACACGttagcacagcaacaacataTAGTATTGAATCCTATGCGGAACGCCCTGCTCACCCGATTCCTT
TGAGCGTGGGAGTCTTGTACACGCCTAATAAGCTCAGTAATGAATATGGATCGAGAAATGGCGAAGTCAGCCACAAAAAACTCCAATTCTGTTTGACCTT
GCGACCCAGCATCAGAGGCCCTATGCGCGACCGATGCGTTGCTGTACAAACGGAGCAACTGCGAAAGAAGCTCACTCTCTTCAACTTCGGAGCTCAAAAG
TTGTAGCGCGTCACTGGGCAAAAGGACAGCTCTTAGGATTTTCAAAATGAAGATAACTGTCGCCTCAGCGCCATTTTCGGTTGCTGTAGACAAACcctgg
acgaagaagaaaacgaagTATGCCTTCATTTCTGCTGGAAACCCACCAAAAGCCTTGGAGCATCCTTTCACCCCACCAATTGAATCCATCAATACGCACA
CACAGCGTAGCTGAGCGTAGATCACCTCAAGGTTGGTAATGGTACCGTGGCATCCATGCTTCTCTTTAGGGTGAAATGTCGTGAATGCCCAGTTCTTCAG
AACCCGAGCAAGAACCTCTGGCGGTTGGGTCTTTTGAATTCGAGAGGATGCGTCGGTACGCGTGCAAAGCAGTGGGGCGGTTGCCTCCCAATGCCAGCAC
AACACACCtagcgctgctggaacggaTAAATTTGAGTCACATGCGTTCtcaccttcaacttcttTCACACTTGACAAGACGATATGGGAGACTGCAACAT
ATgactgcaggtgctggagcgcaTAGCCGAGAAACTGGCGGCGTGTTGAGTGCAAATGCCACTGTCGTTGCACAACTAGGAAGAATTGCATGCTCTCCAC
AGTTTTGCCCATTGAGCCGTCGTCAATCAAATTTCTCTTTGCTTCTTCGCTCGATAGCATGTACTGCGCCGCGACGTCCGCGCACAGCAATGCAAGCGCT
TCCAAGGCGATCAGTGCAAGCTTCGATGGTTTCACATGATGCGAGCCAGCAACCCGAACTGTTCCTCGTTCTACAACGACACACAGAGCATCCAAGTACG
CCCCAAATCGATCACCTAACAAGCACGAGCTCTCAGTATCAGATGTGACAGTCCGCAACTTGCGGCGACATCTCTGCAACACCTCAAAAAGCGTaagaca
agcagcaagctgaTTCTGCTTCTCGGCTGTCGGTTGGATCCATTCCAACAGCAACTGCCGTACGTAGTCATGAGTCGATAATGCCACACCACTACCACCA
CTTTCACAGTCCATCATCCAGTCCAGCAAAACGTGCAATTTCTCTGCCTGCGGGCCCCAAATACAGCAATTCGTTCGAGATGCCGTGCAATCTCGCATTG
ATCGCATcattgctgctccagccacAGTGCACACCAAGTTTCGATTTGAATTTtttgctccagctccttccacTTCACCCTGAGCGCCGTAAGCATTGGC
AACTGATGTCAAAGCAGCCTGCAGTCTTGCAATCCGCTTGTGGtccgacagcgacaacacTCGACCCTAGTGCAGTCAAAAGACCAATGAAttagcagca
acgacaccagcagcatgacAGACCACTATAATGCGCTAAATGACACCTCAGCAGTGCGTTTCAgcacgtcgacgtcgtctgTGCCACTAGGTTTTAGCAG
CGACTCAGATCTGATTCCAGTCTTGACACGCTCTAGACTGGCGATAGCTGTCTCCATCTACACAACCACAGCACGTTAGAAACCCAGATTTGCACGGAGA
GAAATAGAAGGAAGAGATGAATTAGATGATAATTACGTGGAAGAGCTCGCAATCTCCcagcactcgcagcagccgcccCGCGCTGTCGCCATCGCGAGTC
CTCGCCGCCATTTTTGATTTGACAATTGAAATTGTACAATAGTTACGATACATTTTTTATGTGGTACACCTCTTTTAAgcagatggctacagttgAAGGT
CGGTTTTGTTGAACTGGTTGCACATTTGTTCATTGATTGATGGTACCAACTCCATTATACATACAGAGACTACTAGAGCTGGTGGCTTCCTATCTCTCGG
AAGCAATGGGCTTACTGCTGAGGCCTTAGAGCGTCAGAGTGTTGTGGCCATCACGGCGGACtttgtcgacgtcgtagtATTCCGCGCTGTCATCGGAGTG
AGCGCTCAGGAACGACTGGTTCGATGACTGGTTCGATGAGCCAGAAttccgacgacgatgtgACGGGTAATACCTGCCGTCGTCGCCCCCGTTGTCCGTG
ATTCGACTCTGGGCGTTGAAATCGACACGAGATGTCGCGAAGTTGGCCCTCGACTGGTAACCATAGGAATCGACCGAGTCCCGCTGCATGAAAGCTGACG
AGGTCACCCCGAGAGGACCAAGCTCGTAACTCTGACCCTCCACATCGTTCGCCTCACTTCCATCCGTGTCCACGCTGACCACGGTCTTTGACCGACTCTT
GAACCAACCACTGCTGTCACCATCGAAACTGCTTTCGGAATCgttcgagaagatcgacatCTTGGCCTGAGGACTGGTACCGTAGCCACTGGTTTTGCTC
GTTTGGGGAGTAGCAGCCCCCATAGCGGATGAGAACGTGTTATTCGGCTTCGCGGTGCTTTGTGTCATACCCAACTGGCTGCTGGCAGATGAAACCATTG
AGTCCGAAAAGTTGACGTAAGACTGCTCCATCATGGCAAACGAGCTGGCCGTTGAAGCAGCCGGGGCAAAGTGCTGACCCACAGCCGACGCTCCAGGAGC
AAACTGTCGACGGGCTGATGAAGGTGCAGACGGATCTGCCACAGTGTCTCCGTCTACATCAATATCCACATCGTCGATATCCACGTCCTTCTGCAGGCCA
TCCATGTTAAAGCTGCGTTTCCTCCGCGAAGACGAACTACTGACTCTAGAGTTTGCGCCGGAGAAACTGCCAGCGTACGCGTCGAGAGGTACAGTCGATG
GGCGCGAGCCGAGCCCGGAGCCCGACATCCCCGTTGCAATCGGGGCTCCTCCTCTTGAAGATTGACCTCTCGATGACGGCGGACCTCTCGACGATGCCAG
ACCCCTAGATGAATTCTGACCTCGAGACGAATTCTGTCCCCGAGATGAATTCTGTCCTCTCGACGAGAGTTGGCCTCTTGAAGATTGTCCTCTAGACGAT
TTTGGCGACCCAGACTCATTATTCGTGCCAAGGTAGGCTGCCAGCACATCGTAAGTTGGAACTGGTCCCTCCTGAATAGGTTCAGGAGAGGGCGTTGGCG
CAGCGTTATTCACTTCGAAAGCGTCCGCACTTCGAGTCGAGCCTTCAAATGAGTACTGTTGGTTGCGAGAAACCGGTGGACGAATCTTGCCCTTAGAGCG
ACTGAAGACCGGGGTAGCCTCCGGAGCCGGCTCCAACATCGGCACGTGGTCCGAATGATCACCGCGTGAGCTCTCGGTACTGTAGCCGGACATATTGCTT
GTCTGCGACTGGTACTGCTGGGGCTGAttgagctgttgctggtgctgctgcttgttttCATACCAGTCCACACCATGGCCTGCTGGTGTGGTCTCTACTT
GCTCGTAAGCGCGGCCATTAGTGGACGCGTTGTTGCCGAACTCGAGGTTAATGTCCGTGGCATCCAAGCTAGAGTTGTCcttgccgttcttcttgtggcG
GCAGGCGACGACCATCTTGTGAATAATCGTGTAGGCCTGGCgcacgaagagcaagaagaagatgaacatGTTCACACCAATGATACCGTAAGCCACGTTG
TCACGCACGGTCTGTGGGAAGTAGTCGTCCCTTGCCACGATGAGCATGAGGCAGATAAGCACAACCTTCATGAACACCGACGTGATTCCGATGTAGTACA
GGAACCGCAGTAAGTTCGGCTGGCGGATGAGCAACAAGATCAAGTACACCATTGTGATTGCCAGGATACACAATAGCTGCGTCGTGGCATCCCGAACAAC
TCCAACGATGGCACCGGTCATCACGGCCAGCAGAATACGgggcacgaagaagaagcggttGTCGAAGTTGTACTCGTCGTAGTAGACGCTGTACTTGTTG
CTAAACGCCCGCTGGTCGTGTTCGTAAGTGCCGACATCCTTGAGTTCGTCGGCGTTGTTGCCAACAACGATAATACCGAGTCCAAGGGCCATGAGAATGA
CAGCTGCGAGGGCGACAATACCCAACGCGTAGCGTGAACTGGAGCCATTCGCCGAGTCGTTCGACGATCCTTCCGAGATGAAGTAGCTTCCCGCCATCGC
AAACATGTATTGGGCCAGCAGTAGAGCCAACACACCAGCCCAAACAACCTTGCGATACCACTTGCGCGCCACATCACCGAACGACTCGTTCTTGGCTAGA
GCACCCATGATCAGAACGATGACCAGGAACAGtgcgtgcagcaccacaaccACCACGACGAACGTTACAAGAGTGTAGAAGAAGAGGTTGTCGGCATCGA
CACCGATCAGCGCGGCATATCTCGCCGGTCCAGACTCTCCAGCCGCCGCGAAGACACCTGTAGCACTGGAACTGGAGTCTGCAAGTCTACGGGTGGAAtc
gtcactgctgtcgcCTCCACTTCCACTACTGCTCGAGTCATCGCTACTGCCCTTGATCAAGTTAAAATTCGTCCACGAAAGTTCCTTCGAGAACTCCAAC
AGAAAAGTCGGTGCGCCTTCAATGCGCAGCTGACTGATCATGCCTGCAAACTGGGCCTGCTCGACAATGTGGGTCATCTCGTAGAACCCTCCCGAGAAGC
TCagcgctgccgcagcacTGGGCATCGCAGAAGCCCACAGCATCGAACCTGTGCCGATCACCGCCGCGCCAGCCAAAGACGTGGCGATGACGCCCGACGC
GGTGCTACCGGCCTTGGAGTCCAGGAAGTGTCGCGTCCCCGTGGAGTTGGTGGGCCACTGCGTATTGCTGCCGAAGACGCAGCCGGAGCAGCTGTTGGCC
TCGGCGTAGCTGGCGTTCAGGTCTCCGATGTCGACGTCGGACGCAAGGTTGAGCGCCTGGCGGATCTGGTCCTCGCCCCACGGGATCGCGTACGTGTAGA
AGAGCAGGCCGAGCGCGGCCAGGATGCCCAGCGGCAGCAGTAGTGCGCAGAGCTGCGAGAGCGCCATGCAGCCGCAGCACTTGGCGGCGCAGCACAGCAG
CCCCATGCTCGAATCAAGTGTGTGTTAGGAGATCTGTTCGTACGAGggcggcgctcgtggtggtggtgggcgGAACTGGCTTTGGCTGCCAGGACGTTGC
GATGGTGATTGCCTCGAAGTCGATTTGACACGCTTGGGCTTTTGACTTGGTGGCTTTCAGCCCCAAAGGCTGGATGCAGAGGCGTTGACCGAAAACAGAG
GGAGGAAGTCCATCGAGCTTTGGATGGGAATTGCGAACGAGAGACCGGGTGCAACTGCAACAATTCAGCACGGTAGAAAGTGGCGCTCGGGGGTTCATTG
GTAGAAACGTGATCGGTAGTACCGGTAAGTGAGGGGTGTTGATAGTATTTAGCCAATCGCTGATGGCAAAAAATATTCAGACGCCGTTTTGATGTGTGTG
TGAGACGGCCCTTGGCGCGCTTTTGACAAGGTCTCCACCGTGGAGACCTTGTCAAAAAATGGAGTCCACGCCGAACGCGACACGATGGATAGGCTTGGTG
GAATTGGATCCATCGTCGTGGATGTCCAGCTAACAACGTACACGGAGAAGGCTGGTAGTGAACGCATGTCCGCTACGCATTCGGTTAAAGTTTGCATGGC
GCAAATAAGCATGCAGCCGCTTACGGTGTAGCCGCCATTCGCTGATCGACAGGGCAAGCGTTGGGGACCTGGATGCAACTATATCcgctactacatgtac
acttcTACAGTATTACAGTGTATTGTGATAAATGTACCAAACATTGTATTAACGCCGCCCTATATTTCTGCGGCCAACGCCTCACTTGCCGTTTTTACTG
ACCCCGCCGTGCTGCGGACCTTTGCGGAAAGTCGCTCATCGATGTGAGGTTCAACGATATGAAACCTCGCGGACAAAAATGGATCGATCGACGACGGCTT
CAACGTCACCGCAGATGTCTTGCCGATGCCTCGCCGAtgcggcggcggcaccgTGAGTCACGCGTGCGAGTCGCCATACGAAATTGAAGGTTGTACCGGT
ATGAGAACCGGTAATTATCTCGTTTCTGGCAATTTCTAAATGCGGCTCAATCACTTCTAacgtgacagcagcaaccatgACCAGCGCCACGCACCCGTTC
GAATGGTACGCCCGACGTCACCGCCTCTAGTCACTCGCTTCTAGCGACCTCATCGCTGTTACGCACCGCTTATCTCGTTTGTGCTGCCGTCTTCTCTACA
GCGATATATGTCTGAACTTCCCCGAAGAGGTAGACGCGcagaacgtgctgcagacgctcgaggTCGACGCCGAGCTGCAGCCCGAGAAAATCCACCGCAC
GTTGACCGTTAAGGGCAGGGAGCTCCACGTGTACGTTTGGCAATGCTTCATTGGCGGTTGCTTTTTGACTCCATACTATGCTGACACCTTAGAATGTTGC
ATCCTGTTTGTTGTGATTGAtggttggtggtggtgcaaTGCAGCCACTTCGAGGCCACGGAGATCCGACTGCTGCGTGCGGCGGTGTCTTCCTTCTACGA
CATGGGTGTGCTGGCAGCcaggacgctgctggagtttAAGGAGTGAGGAAGTCGAGGAGAACGAAATACAGAGTCTACAAGTTGTTGACTCATTCGGTTC
TGCGTCACGACGGTTGGAAACGGTGATCCACTCATCGTGTATGCTGCCGATGGGCCTCACTGTCCACAACGTCGCTAAGTGGTTGCAACGGGTTCAAGAG
GTGATATGCATTAACAGCGAAGTTACTTCAACTGCCAGTGGCTGCGACGTGGAGTCGTGCAGCGGGTAAATACGTTGGGGGCTGCGGGGCGTTGTGAATT
CCGGCTCCCGTCGAACGGTTTTAAGTGACTGCAACAGCATGGAATAACCAGTTTactttttgttgttgttcgcAACGCTTAGCTGGCTTAGTACATGCAT
GCGTGGGCTGCATGGCAGTGCACATTTTCTCTGCTGGCAGCACATTCCATGATTCATCTAGTCGTATTTTACATAGATACACTGCCATAAGAGCGAATCT
TGCGAGGTTCTTCGAAGCAGCTTGCATTGACGGCGGCTGTGACGAGTTCTGGCATGGCGAATGTCTATCGCGGAAACCTCAACCTCTTCAGCGACTTGGT
CGTTGTCGCAAATTGCATCGTGTGCATGCAAGCTTAAacgaggtacatgtacatgtaccggggtggattttgctgcttgctcaaTTCATGCCGACGCCGC
CTCGTGTTCGCTGCTTTGCTTTGCAAAAAGTTGCTGCGGTAAGGAAAAACTTTTCCTGACCCCGGTGAAAATGAGGTGGCCAAAGGTTTAATTACACGTA
GTACAGTTGCTCGGTGACGTTGCGCGCGTAGCAACAGAGTGGAGCGCTAAGTATGTGGCGGCAGTTTTCGCGTGGTACCATGTCGTCTGCATGGAGCCaa
tgcccagcagcactcaCGGTTCATTTTCTCCGGACGGATGCTATTCCTGCCAGCAACGCTGGCCAGTGAACCCATGGGAACCCAACGGCCAACAGCGCTG
GCCTGTGAACCCCATGGGGTCCCAACTCTGATACAGCACCGCACTGAGGTGGGCGCTTGCCACCCAATGGTTGGTTGGGCAGTGAGAGCTGGGCAgactg
ctgtcgtcctcagCCAACTTGGTGTGGACGTCGATGCGGCTCGAGTCATCTGCTGGGACGTACCGTAGAATACGATGCTTCATATTCCGTGCCCGGGTGT
ACCTGGCCTGAACCTTCAAGATTCACCGATGCAAACCAGCCATACATGTGTACGGACTCAGCCTCCGTACTGCGGAGACTCCCGTTTACCCCATGGGATG
CGTGAGCTCCCAGTCGTTGTGATGACCAGTCCTCTGCGACCTGTTGGCGGAGACACACATGGTCGCAGCTACAGCAGAAGCTCGCAATAATGGAGGACGA
GTTGAGCCTAAGCAGCGTCGTTTTTCTGAAGCGGCAGTGTGTAACGTGCAAGTTGTCGGCAACTTGTGTCAACACCGAGAGTGCATAGCCAGCCAATTGC
TGTCCAGCAGGCTGGTTTCTGATCGGTCAAGTGCTGTGCCCAACGCTCTCTGTCCCTCTCCTGCTCATCCCAGTGGCAAACTCATCCTTGTCGTTTGGGT
CAGCATAACGCGCAGGCTTTCATCACTCGCCAATTCACGCGCTTCGAGAGAGACAACCAACGCCGGTGGAAACCTGGGCTAGGTCGGTTTTACACCGTTA
ATCCGAACAACATGCCTGCTCTGAACGTCGACGAGTTGGCAGTTAGCACGCGTGAGCTTGTGGAGCGTCACATGACCGAATCGTTCGCCAACCACCGCCC
CGTGTCCTTCGATgactcgctgcagcactcacACCACGCGTTGCGCGGTCGCAACTCCATGCCGGCAGTGCTGCGTCTGTCGTCGGACCTCGGTTCCTCC
CGCCTCTCGAGCTTCGGCTTCATCCCCGGACACGAGGTCATCGAAACCAGCGTCCGCTTCTTGGGCGTTACCCGCGTGAACAACCACTGCGCCTTCAAGC
TGCACGTGGACACTGGCAGGGAGCAGTTCGTGCTACAGAAGCGCTATTCACAGTTCCGCGACTTGCggcagcaattgctgctaGCTGGTAAGGTCGAAGG
GGCTGCGGATGAAGAGGGACGCAGAGGTGAATGCCTCAATGGCGCGTGTCAACAGCTTGCACAGCAACTTGCCGCGCTCAAGTTCCCGCGACGCAAGATG
AAATTCAAGTTCCATCGAGATGACGACGTCAAAACTGCGAGAGAACGACAggctcagctgcagcacttcgtcgAGATGGTGCTGGCGGTGTATCGCACTG
CACCGAAGCGCCAGGTGCGCTGCTGTGTCAACTCGCAATGCCGCATACTCAAGGCCATTCGATCATTCCTGGATATCAAGGACTTGGGTGAAGACGAACT
ACTAGACTGGAAGTCGATCAGCCAAGGCACTACCTGCTCTGATGGAGTTCCGATCCTGGACACCCCGCCGTCCACGACATCAAACCCGTCGCCAGTCAGC
AGCACGGCTAACAGTTCGAACGAGTCGCCAATACCAAGGAAGACGTCGGTGATGTGCTTGGAGGAACTTTACACGATTACCGAGGACACGGAGCACCTCC
ACGTCTAACTTAGACGATGTGGTAGTCTCAATGTCTTGCTCAACAGCTAGCCAGCCCAACAACTGTAGTAACTTATTTCTCGGCTCAATGCCAATCCATT
TTAGTCAAGTAGTCAATTAGTACCAAGGCAACTAATTCGCTGGCGTTGCCAACCCCGCTTCATCGAAAACTTGAGAAGATGTAGCAGACCCCTAGTACTG
TAATCACACGTTCGCATTTGAACTCGTATATGGAAATTGTCAGCATAAACCTCTTTAGTGTTCAACGCCTTTAGTCTTAAAGAGCTCAACGATGACCGTG
GACACTtggtcatcgtcgttgcGTAGCCCACCCATGATCTGCGAGGCCTTGCCCCACTGGACGTTGCTAACGAGCATCTGCAGCCAGTCAAACGTTTCAC
ATTAGCCCAATATCGCCGTGAAAAGAAAGCTGTCAACGGTCCACTGGGTTGCAATGAGTTTACCAGTTACCTGTTCATTCGTGTTGTCAGCGTAGCCCCG
ACCATCCCGATTTGTGTTGTCGCTGCTTCCAGCGTGTTGTCGTGCCCactgcaaaaaaaaaaatatcaCAAACCAGCAACGTTGGGGCGTTCAACTTCAC
TTCATTCGAATTCACGAAGCACTTACACTGAGCCAACTGCCGTCATTTCCACGGGGACGCCGTGGGGATGGTTTAGGCTTGTCGATTAGTGGTTTTTGAG
CTCGTCGGAGCTGGCCAGAGGAGACGCCTGGTACCCCTCGTTCGGTTTGTGAGCCCCTACCAGGCGAAAGTGGCAGTTTTGGTAGACAAAAGTTGGGTTC
TCGTGCTGAGCGATGACCACCAAGGTCTGGTCGTGGCCCCATAATTGGAATGCGTGCTTCCTCGTGCCTAGTGAGAACAGAATCCACCAACTCTTGTTTG
TACTGGTTCCATCTGGTCTCCCGCTTTAAGTCACTCATGACGCTGGTAGCCTCGGCGCGGGCAGAGAGACCAATGACTTCTTGACGCAACATTTGCTCCG
TGGTAGCGTCTTTGAGCAGAATTTGTCGAAAGTCTACGCGGTCAACGCGATACAAAATGACCGTCGGTGAAGAAACTAGCACAGAAAATACCGCGTTGGT
CACACCCAGGACTGCCTCGTAGAATCCGAAATAGTGTTGACTTTACAAGATAGGAAGTGTTGTTAGTTACGTTGGAGAGTGCATGTTGAAAGCTGTTCAT
CGTTACCTGCAGACGGTAGATATTTCAACGAAACATGGCAGCTTGCGATCGCTCTGCTTCTTTGTCTGTCCGAGTGCCGAGTAGCGCTTGACAAGCCTGC
ATTCACCATGTTTGATGAAGTAGAAATAGTCTTCGCGCAGAGTGAGCAATTTTCTGCTCTTTAGCGTGAATAACAGTGTTACGTACTTGCAGGCTCGCCT
TCGACAATGATGACATCGTTGTATGTGTGCTGGATCTTATCCATTCGATCACACAGCTTTAAGATTCCTTCGTCTTCCCAATGATCCAGGCACGCTACAC
CAGCTAAGAATGTCATTTTCTCGCTATTAGCAATGACAGAAACCAGCGGTTAGATTGGACGATTATTACACGGATGAGATCAAGACGTACCGGAGTTCTC
GAGAGAGATTGCACGCTCTTAGCGCCATGAAGGTGTCTCGATCAATCTGCATGAGTAGTGTTGTTTCCGTGGCTACTACAGACGCtgtacgctgctgctc
ttcaagaagcaggcCGACATCACCGAATACTTCTAGCGGCTTCATGGTGCGGACAACGTACGTAGCATCGTGCGACATATCAAGCTTTCCACCCGGATTG
AGGAAGCTCGAGTGCACCCGGGCGCGATTCATGATCTCCTCAAACTCGTTCAGCGTGGGAGCTGCCATGCGCGAAAAGTCCATGACCACACTCATAGTGC
CGAACATGATGCAGTAAAAGGCATCAGCACGGTCGCCAATCCGAAACAATGCGTCTCCATCCTCGAGCTCAAGGCCTTTGGCTGCCTTCAAGAACCGCAG
TCGATCTCTCGACGGCAGCTCACGGAAGTATTTGACGCGATGGACTGCACCACAACCACCACAACGTTAGTGCAAACATCACAAGACCAGAGCATacgaa
aaaaaaaactattCATGTATCTAATGCAACGCACTATAGTTTGCGAGGAACTCGTAGTCAGCCTTGCACCTGGCAGCTtcagacagcagcaatatgCGTC
TCAAGTTGGCATGCACTTCAGGCAGCTCGTGGTTGGGCTGCTCCTGCCAGCTCGCTCTCTTCGACAGCCTAGTAAAAATCAATCAAAGCATATTGAATCA
GAGGTCGATGGAAATGCTCGGCAATCGCTGCAAAAGCGCACACGCACATGCTTCAACTCTTGTCGAGTCCAGCAGAGGACGtcaagtgtagccatttctA
TAAATGGCTATATCATCTTTAGTGTGCACCACACCTTGTTGTACCTGTCAAAATGGATACCGTACACTCAAACACACTCCCATAATTTGTATCGGCTCGA
AAGGTGAGGGCGGCGTCACGTTGGCGCACCCGCTGCTACTTCATGCATATGCACGGGACCCCCCGGCGCTCTATCACTTGATCCAGCACTTGCACCATAC
ATTTCTCTATCTCACCTTCCTGTTCATGTCAATTATATGCAGACACGAGCCGTCTATCGTCGTCAAATTCTTCGTTTAAAACACTATGGACTCGGAAAAC
AAGAAAAAGTGtgccgacgtcgtggagcaTTTCTTCAAGCTCGATAGCTGCGGTGAGAGGCAGTTTCGATTGCTATATTTTTTTAGGATGCTGTGCAGTT
GGTGGCAATACACTCATTCATGTGTGTACTGTGGTTGTAGAGCCCTTCCGCGAGCGTGTCAACTGGGAGGAATGGGGTCTGTATGACTATCTCCAGGTGG
TCAAGGAGCCCATGGACCTCGGCACCATCCGCAGCAAACTGAGCAAGAACGAGTACAAGAAGTCGGTGGAGTTTGCGCGCGACATGCGCCTGGTCTGGAA
CAATTGCAAGCTCTACAACCAGGACGGCTCCGACCTGTATCTGCTGGCTGACGAgctcgccaagaagttcgaggACCGTGtcaagacgatgaagctggaT
GTCGGTCCGGTGCCCAAGGCTGACAAGAGTATCCCGTACGGTGTATTGATGCTTGGTTGAGGTTTTTAGCCGTTGGTGGTTCTAActtgtcgtgctgctg
accAGAGCTCCGAGTCCGGAAGAGAAAATTCACTTCAGCCAGAACATCTACAAGGTCGGGCATGAGGACCTGGGCGCTattgtgcagctgctggaggagc
agtGTCCgaaggcgctggacaagaGCTCGCCAGACGAGCTGGATATTGCCGTCGACCACATCGACAACAAGACGTTCCGTGACTTGGAGAAGTTTGTGCT
AGAGAAGGTACCTGAGGGCAGTCGCGAGCCGATTGCTACGCCCAAGTCCTCGAAGAAGTCTCGACGGCCAccgagcaagaagaccaaaACTGAAGCGTGA
TCGATGATGAATTCGTTTTGAGCGTACCAGATTAGCCTTGACTTGAGTGACAGTGCCATGCCATCGCTGTTCTGGATGCGACTGAAAAGAGGGAAATGGC
GCGTGTATTTAACCGCATCCAGGCACGCAGTGAACATCGATCCCCGATCGTAAGGATATTTAGTAACCTCCTAATCCCTTACGCTACTTAACTTTGTTTC
TCTCACTGTGCTACCTACTTCTTCTTTCGGAGCGTAGCTGCAAGCCGAGTCTGCCGTTGGAACGTGGCGTCGAAGCTCTTTCTCTTCTGCTTTTGTGCGG
GCTCGCTGGACTCTTCTTGAGGAGAAACACCTATAGCGGGTCTACCTCCGAGCCTGCTAAAGTCTAGTGGTGGCACATCTATCTTCTGCGTCGATGGTGA
TACATCAGATTCATCTGTCGGCACTTCAAACTgagcaggaactgctgctgaaagCTGCGATCCTGCCTTCGCGCGAGTGGATTGCCACTGAGATGGAATA
AACTTTGGACCATCGGGTTTCGCCGCTGCGCCAATGCCATGCGATGCACTTGGAAGTGGAGCTACTggttgcagcttcaacagtGGAAGGTTAAACTTTG
ACGGACGTCGAATGGCTTTTCGCTCTCGAGAAGTTGAAGACTGGCGACTCGATTCTGGCTGATTTTGGAGCGAACGCTTGtactcaagcagctcctcctt
gttgAGCTCCATTAGATCTCTAGTCATCAGTGTAATAGGGTGTGAGTGAACAGGAGTAAAAGCTAAAGACCATGGACATGTTTACCTGAGTGAAGGTTCA
TCCCCGTTGGAGGCGTTCCAGTTGTCACCGTGGATCTTCTTCCCGGCTTTCATAAGTTTTGTCCATTCCTGCCAAGGCAAAATTCAAGTGACCAAGCTGT
TTGAAGCAAAGTGGTCAAAAAGCAGTGAGATTACCTCCTCATCACGTCGACAGGTTTCCACTCGGGATGTCACGATCTCCTCAAGCTCATCATGGTAACG
TAGCTGATCCTGGcgagctgcaagctgctcttTGAGTTTGCCAATGTATCGTTGGAGATCCTCTTTTCGCCTCCCAATCTGTTCGAGCACACCGCTGCTT
GactgttgaagttgcagtggtGGATGATACTCTACAGTTCACAACATCAAAGCATGAATTACGCCACTTTGCCGTGACGTATCCATCGAAATCGTTGTCT
TTTGCGTACTTGTTCGTCGCTTGCGCttttgcatctgctgctggaagaagcccAGGACaagtagcaacagcaggacACAACCGACAATCAAACCTGGAGT
GTTGATCGTCGCACCAGCTGCACTTCGAATCCGCGGCATTTCGCTTGTTTAGCAACGAGCCTGGCGTTGATGCACACAGCAGAGCTGAAGAAAAATCAGG
AACGAAAGGCATCTATTTACGCGGTCGCACGGCAACAAAGATCACGCATTGTGGTTGAAGTCATATTTTTAGGTTTCTTATCATGCGAAGCCCAAGCTTC
ATTAGCCTCTCGTGTTCATACAGCGTGATGCCTATCCATAGTTGGAGAGCTCTGTCCATTCGCTCTCTGTCCATTGAGGCACTCATATCACGTCCAATCA
TCGATGAAACGGGCGTATCTTGGCTACGTACGAACGTATTCATGCTCAAGTCTCTGGGAGGTTTCGCAGATGCTTAAGGTCATGGATAGACTTACTCGGA
GAGAAGCGCATTTATTTCGACTGGGTGTGCGTGTGCTTTCCTAATCTGTACAGCAAAATAAATAGGAGAATGCGCGCGACATAACCATGCTCACACGTCA
GCGACGAACAcgtcttcatccacgacGAAAGACGCGGCGTCGAAGTTCACGGCAGGTTGGTCAGCTGGCATGGGCGTGAGCCAGTAGTCACCGAGATCCA
GGTTGTCCCAGCTCTCGCCGACATCCACGGGCGAGGTTTTTCCCTCGGGCAACGCAGCCAGCGCTTCCAGTCCTGAGGTCGTGTCCAGACTCTTGCAGGC
GTCTCCCTGTCCATCCTGCAAGATacgctccagcgcctcctcgtccactCCGTCGGAGAGACGTTGCAGCTCAATAGAAGGCGTCGACATCATGGGCGCA
GGAGCCAAGACCGGCTCCTCCTTGACCTGGAATCCAGCTCGGTCGTAcacgccgtccagcagcacgagatcCTGGAGGAACCAGCTGGTGagtcctgcag
ctgcggccGTGTCTCTGGTGGCCTcctccgcctgctgcttggcgcgcgcctcctccttcatgGCCAAGTGGGCACTGAGCGGGGCGCGGCGTGCCCGCTG
ACGCATCTTCTTGTGCGCGCGGAGGCGCTTGCCAGCAGGCTCCGAGTCCGTGGACACCTGTGCGCGcgccttgcgcttgagctcaaGCCGGCGCTGGTTC
TTGTTGGCCTTCTGGCGATGGAAGTCGCAGAGGTTGTGGCTCTCGCCGTTGCGCTTCATCGCGCGCGGgttccagcacttcttgCTCGGGTAGCGGCACA
TGACCTCGGCGTCGTGCGCAGGCTGCtccggtgctgctgttgtggtaCCGGTAGGCTGCGCTCTGGGGGAAGGAGGAGACGCATGCGgggaagacgaagc
tgcgccGGGGCGAGTGGCCATCATCGCGGGCAATGCAATGGAGTGAACAGAAGGCAAAAGGGCGAATGACCAAACACCAGCCAGCCACGCATGTCCGTCC
GTCCGGAGTCCGACTGTTGCAGTCAGTTGCTGGAACTTCCAGGAAGATACCGccaactgcagcatcaaatCGGGTACGATAGCTACAATATGGGTGAACT
AGGAACCAGACGGTTAGAGTTTGAACCCATAGTGTATTTTGTGCAGGATTTCGTATGGCGCAGAAAATCAAATGCGGCCGGTGCCACCTATCTTCGCCGC
TCGGAGCGCCATCGACTGCCGTCAGAGCTCCGACTGGTGTTTCTGCTCCGATGAGTGGATTCGAGTGGGAAACCACTGTGAATTTCACAGTGTGAAGTCA
CATACGAACGTGGTTACTGCAGCGTGGACGCGCCTGTGACAGCGCTGACTGACGGTGATCAAAGCACCGGCGTCGTCGGGTAATCCAAGCCAAGCCAGCC
TGACTATGGCAAGCGGGCGTGTCGTGTTGATGATGCCCAACGGACGGGGCAATCCAGTCGACAGCGGAATTGTCGCGCAGTTTGCTTCCAAGCCTtagaa
cttgctgctgctcgcgaaTATCCATCCATCAGGCGCTTGCCTCTTGGTACCTTTGgtgcatcgtcgacgactACAATCAAGAAACTCTGGAATTGGTTTC
AGACACCGAGAGATTCCTAGCTGAGACGAACACCAACCGTTAATTAACGACTTTGAACTCGTTCTCTTCCGCACGGAGAAATTATTCACTTTATTGCTTA
TGAACTTGTACTTTAGAGTCTCTTTACTTACGGTAATGGGTGGGCGCGACTTCTCTCGCTTAAATGTTGGCGCGGGTGACGAGTGTTGGTGCTCGTCGGA
CGACCGGCTGCcacgagcgctgcagcgtcgcggAGCTCACGAGTCCTTCACCTGATCGCGCCACTGCCGTCGCAatcggtggcagcagcatggacgGAGA
CGCGTCAATAGGTTCCGCCTTCGGAGGAGTCAACAAGTTGCGGTGCATCCACCCGCTGGCCGGCTCCATCTTGGCCATTGCCGCCACGCGGAGCATGGCA
CGAGGGCTCCTCGGGTATGTCGCGTCCATCCACTCGGCAGGTGACAATCGACTCGACTCATGCCACGAGTTCAGTCCGCTGCTGTACGTCGGGTGACTGT
TGTGTGTGCTCCCCATGGCCACGAggcctgctgctcgctgcagctccgcaAGGGACGCGGTGGCTCGCGGAGGTGGTCGGATGTACTGCGTCGTGAGGGG
CATGGCgcccagctcctgctccagcttgagcGCAATGGAGGCGCGCATGCGCATACGACGCTCCAGGTCGGCGCCGGCGTGTAGCGGCAGGTGGTTGGGG
AGACCAAGTGTGGCCTGGCcggccttgcgcttcttgtcaAGTCGGCGCTGGTTGCTGTTGGCCTTTTGGCGGTGCATCTCGCACAGGTTGTGGCGCTCTC
CATTGCGCTTAATGGCGCGCAggttccagcagcgcttgctggcGTAGCGGCACTTGAGCGCGCTGAACTCGTCGTTTGTCGTCTGCATGGCTCGGtcaga
ggaggaggagaagcaacTTGTGTGGAGGTGAcaaattgaagagtgagcAGTTTGGTGTGGCTAATACGTACACGGCACGGTGTCTTCAAGGTGCAGACAG
GGTAGAATCTTAGCCTGAGATGGTTGTTTTAATGTCGACTTACGAGCGGAATGGTGACTTACCAAACGCAGCACCAATTTTTGCAGCATACAAAACGCGA
GACACGCGTCGACTTTAGGccgaggagacgctgcgtgCGTCAACTTAGCGAGATAGCGAGATGTCGCTCTTTTGGTGGGGCCGGGAGGAGAGGAGACGCC
GAAGATGATTTATGTTCGGCGCTAGTGCGGCCTTCGCTGGCTTGCAAGTAGCTCCGGACCGATGCAAGATAGCCCGGAAGATTTCCATGCTCCACATTGC
CAGGTCGTCATGGGTCTGGGATATTTGCAGCGAGCGGCACTGATTCAAGGCCAGACCAAGGCAGTTTAGTTGAGCTGGAAAACGGCTTCGGTGACTTGCT
CGGGTTGTCTCTGCCGACCGTTTGTTCCTGATTTCTGTAGTGCGAATCAGTTCGCTACCACTCCACGACTGAAGCAACTCGGTGCCAGTGCGATGGGGAA
GCGATCGCGAGCAACATTTGGGGTGTGTGCAAGCAACGCCGAgtcttgttcttgttgtctTGAGGTTCCGCTCGTTTGCCGGAGGTGACAAGTCCCATCT
GGTGTTGTCGGCTGAAAGAGCGGCGAGAGAGTGCTGAAGAGGCTGAACTCACATCGGggcgcaagcagcaaaataTCTCGGTGTCTGGCGTACACAACAT
CGTGACAAACGAGGAGAATAAGCCCGGAGCTGGAAGATATCTTTGACAGGAACCAGGAGATGTCACGAGATTCTCCATGTGTCACCAAGGTGTGCGCATC
GCACTTGGTGTCTATACTGACGTCAGCAGGGAGCTACTGGTGTGTCTTTCCTCACGCTACTCGATCGGTCGAAGccgtgctgtcgacgagctgcgtggGG
TGTCTacatgaagaagagtgcCAGGTTGTATACTGTTGAACTTGGCGCACGTATGTGCCATGTATGTAGGCGAGCTGACTCATGCTTTGTGGTACATTTG
TGCTGTAATGCTAGCAGAAAGTTGAAGCGGTAGGCCACTGCCAGCATGCCACGCTGGCAGTGGTGCTGAgcgtgctgaagctgtcaGTCCGATGATCGCG
GCTTGGCAGAGTTGAGCCTCACTTCGCAATAGACCGCTACACAGATCCTGGGATCCGTTCAGTAACGCGTTGACTTAGCGTGCTCCGGATGCTACGCAGG
CCTTACGCGCGAGACGCACTCGACCAGCGTGGCGTTGCGTTCGCAATAAATATGGGGCACGTGAAAGCAAGAGGAAGGCGGTGCGATGCATTGGCTGAGG
TCTCTCGTTGCGATGCCAATTTGTCAGTTCGGATATTTGTACTTTTTTGACTGGCAAACGGGTTCACTTGCGTATCTCCCTTGTCTAACCTGGATTGTTG
CAACCATGTTTCACGAGCACTTGGCACGGCCGTTAACTTGATTACCCATTACCCATTTGTTCCTTCTTAGCAAACTGGTTCGTCGTCAACGTACATGGCT
CCTCCACTTACAGAAATGGTTTGAGTCACCTCAACTCAACGCGACGATCAAAATTTGTTTGTTGGGGTGACTGAAGTTTCAGCAATCAGATCGTCAAAAC
CCTTTGACACATAACCAGTTGAGCTCAGTTCCGCCGTTGCAAACTAGCATCGACCAACGATATGCTCATTTCATTCGACATGAGCTCTCTTTCGTTTGTC
AGGATGACGTCATACTGTAGCTAAACAGGATGCAGACATCAAGAAAGGAAGACTTGAACACTGTATGTTCAGCTGCAATAAAATAATCAATGTGTCTCTT
ACGACATCTCCCTTTTATTCGAAGTCTGAACCTCTGAAGTGCTTTCTTTTCTCGACCTGCACCCAACCCGAGATGTCGGCGCCTTAAGCCTGAAGCTGCG
TGCCAGTTCCCTTCGAGGTGGTTTGACGTGCTGTGGTGACTGCAGTCGCATTGTTTGACTCATCTTAGATTCAAATACAGCCATTTTGCTCGGTGGCAGG
AAGAGATTTATATCCACCAACTGAAATGCAGTAATGCTGCCTACATGCACATGCAAGTATAACCGAACCTATTACCACATGGTacgcacttcaacttcgc
gcATACAAACGTTAGGTGACTACACTTCAACATTGTACATACAAAAAACAAGTATATATCCCTGTTGACCGGGACTGGGGTGAACACGCATCTTGGCGAG
ATATCTCCGGCAGCCTCAGTAAGACTCTCGCTGGGGCTGCCAACCACTTAGGTTTTGCCAATGTTTCTGCAAGTTCGTTGTAGGGCTGTGGGTGTGAGCA
AGAGTGCCTTTGCACTCAACCCCGACGTAATGCCAACTGCCTTGTTTGATGTTGAGGTGAATAGGCCTCTTCTGATGTCGTCGGCTGAAGTTGCAAGAGA
GAGCGCCGAGCGAGGCTGGACTGACGTCGAAGATAGGATGCTACAAACACTGTCGACGCTAGAACTCGAAGACAGTTTTACGCAAATCTGTGGGTTGCCA
TGAACACGGCGTGGCGGCACTCCTGTTCTTATGTTGTAACCTCAGCGTCGCCAGCGACGCGCCTATACTCGCGCCAGCCTGCCGCCTTTCCTCTTCGTGT
AGAACTGCAAATTGCAGTCTGCAATGGATAAATGGAAGAAATTTACGCTGGCCTAGTGGATAAATGCGGATTTCATCTGCCAGCGGCTACCGTAGCTCAA
GATGACTCACATGTGGTACAGTACATATGTATACAGGGATGCTAGCCCACTGTCGAACTGATGATTGTCGTACAACACACGCGCTGTAGAAGGCGAGTTG
AGGCCGACTTCCTCGCTTAACAGCATCAACGCAACCTTTACGCGTGCTGGCATCATGAGGTAAGCAAGCGCTTCACCTCAGCTCACGCCCAGCAAAGCAA
CGTGTTGACTTAGTGCGCACTCCAATAGAAAAGCAAGTCTCACACGAGTCTTGCGCTCAACTTCGTTGCGTTTGTAATAGTTATGAGGCGCGCGAAAGCA
TCGAGTTGGGGTTGCAAGAGGAAGCCGGCGCGAGGCATTGGTTGTGTGTGTCGACGTCGGTGCACTTCATCCATCAGTAGCTAAGCCGAATTGCTCTCCT
ACTACTGTGTCTCTATTAGATCAGATCATTTGTACATGCATGTGCATGTGTCCACACATACAACGCGAGACCTGCTGTCGTTCCTGCTCCGAATGAGGTT
TGGAGCGAGTACCTCACGGGCGGTAACAGCGCTTGACAAGAGCTCATGAGCTCTGGTTTGATGCAACTAGGTGTCCGTAACAGCAGTAGCGAGCACCAAC
AAAACCATTTTGACGGACCGCATGTACAGAATCAACGACCTATTGCTCAAGCAGGTTTGATTGTCATTACGGGCTATGAGGGCTAACATTTCTTTTCGTC
TGCCGGCTCACCACAACTCAAATGGGCGATCAGAGTTCGTGCTGACCGCGTTGCATTGGTGCAATGAACattctgcagcttcctcggcTACCCCCAATTG
AGTCCAACGATCAATCCGTTTCTCTTAGACTTCCAACTGGTTGGCCCATGTATTATTATCTTGTTCAGTAGCACCTCCATAGCCGTTTGCAACGGTCGGT
GGCGAAACTTCTGTTGGTAGCCAGGAATGGAAGCCAAAATGTGCTAGTACAGCAGTCATTCCATTGTCAACAAGCCACCCACCGATAGTTTTCCTCTGTT
GCTTACAAGAATCCAACATCTCATGATATGGTGAACAAACGCAGCAAGAGGCGAGCCTCCTTGGCGTCCCGCAACCTCCACCATGTTGCAAACCCACCTC
ATCGCGGACGACGTCACAGTGAAGCTGCGACCTCTACCAAAACCAGTGAACTCAGCTCTGCTGAGCCTGTCATTGAGAACTCCCACCTTTTGCCAAACCC
TTCGAGATTGGCCAACGATGGAGATATTTCAGCTTTGGAAGAAGGCGACCTCAaggatggcaagaagaagattgtTTTGATGTCGCCTCGACTGGATGCA
CAACTCGGTGGGTACCCGCCGGATTGTGGCACCAAGGAACTGAAGTATCTTTCGTATGCCAAAGTCCTGCGTGATCGTGGAATGACGCACCCGATGCGTT
ACTCAAGTACCCGAAAGGATGCACTGGGTTTCGCTTTGCCAGAGCGGTACCCGTTGTTCTCCACGGACTTTGGTGCACACTCCTTCCATCACCTGTCGAC
AGACTCGGTTGTACTGAGCCAATATGGTCTTGGAATCGCACTCTACTTTAAATATCTCAAGGTCATCACATGgctcttccttctgctcgtcgTGATCAGT
GCTCCTGCCCTTGCGGTATACATTGTGGGTGGCGGCACTTCTATCGCGGAGCTTACTGCTCTTGCGCGTCAGGATCTCCCGTCTGTCTTGGGTATCACCA
GTATCGGTCATCTTAGCGAGGCGAGCAGTGTGTGTGATCAGGCTCTCGAGAATACTGAGCTATCGCTCACGTGTTCAGCAGGAACGATTAACTTTGTGAA
AGCGGTATATTCGACCTACGACTCCCAGGGAAGTTGCACGTGTCCGGAACGCAACAAAGTTGCTGAAGGTTCTGGTAAGTGTCGTGGCGACATAGAGGGG
TCCGTTTGTCCAGCGGACGGAGCGGGGTGTTTTCTTGGCGTGCACCCGGTCTCACTCCGACCTTGCTGTTCATTTTCACGAAATGAAAAAACGAAAACTC
CGCTCTTTGACGAAATGCGTATTCGAGAAAGTGAAGGTTGTGGCTCGAACATGGCCCAGCAAATCGTCGAAGGGCTCTGTCTGGGCAAGAAAAGCTGCAC
ACTCAACGTCAGTGAGGCGATCACGTACAAATGGGAACCTGATTCCATCTACGGAACAAACTGCTCCAAGTCTCCGACTATCGTCACTATCGACAGCGTC
GCTAACATCACAAAGGAGGTGTGTGAGGAGCGACTGAACGACGATAGCGATTACTCAAAGTGTAAACCCGACAAGTCCCGTGCGTTGATTGTGTACGGAC
GGTGTTTCACTACACGGATCGACTTGTCCGGTGCGTGGAGCCTAAAGATCATCGGTTGGGACTCGATGAGCGTAAGCACGAAGCAAAAGACCTGCTCTAC
TTGTTATGGTTTGCACGAGTACTAACTAATTGTCCTTATGGGTTGGTATGCAGCGGCACGAGTTCTTAGGACTCGCGGTAGGTTGCGATATCGCCTGCAG
TTTAGTGTTCTTCGGCGTTGTGATTTGGCTGCGGCGACAGGAAAAGATAGCCGCGGACCGTATCACCCAGAACCAGGTCAAGGCTCTCGACTACACCGTA
CAACTTGTAAATCTCCCCCACCATGATGATCTCAACTTGCTGCGTCAAGAGGTTAATCCTAACTCACTCACTTGAGAACTTTCCAATGCCTATTGGTAGT
CTATTCTAACTCCATTTTGTGTGGTTAGATTCGCCTGCATCTAGAAGCTGTCTTGAGCAATGCTCCACCATTCGCAGTGGACCTCGACCGGATTCGTGTC
GCCGACGTTCAATTCGGCAAAAGCGCATCACGTCACCTACATTTGCTAAGTCGTCGTGGCGTTATCGTACGCCGCCTCGAAatcgcgcagcagcgtcatg
agAAGTTAAAGCTCTTACACGGGCGACTTAATGAGCGCGTGTACGCTAGACGTGAGCGACGGCATCTGCGTGCTATCCACAAGTtgcagacgaagctgca
cggCTTCAACGTAAAACTGGAGCAGTGGCACGTCCGTCAAAAGCGGTACAACATCTCGCAAGCCGTGACTGCTTTCGTGACAttcgaagaagaggaaggc
aTCCACCGCTGCCTGCAAGAGTACCCAGATCTCGGTTGGCTCCACCGTCTTTTCCAGCCGTACTACAAACGGCTACACGGCAAACGGCTTCGATTCCGGC
CGGCGCCAGACCCGACCGATATCATTTGGGAAAATCTGCATCATCCATTCCTTGAGCGAGTGTTCCGACAACTGGTAAGTTTACTACGAATCAGTACTCT
CGTGAATCGTGGAGCTTTTCAATCTAACTCGCACCTTGTTATCCGACGTCCGGCAGATCGTGGCGTTGATCACGCTAGCTGTGCTGTTCCTGAGCTTCGT
ACTAATTTTTGTGGCGAAGGAGCAGAAAAGTAAGCTTGAGAGACAATTCGGACGCCCAACCAGCTGTCCGACTCAAGTTCTCAAGGCTGATGTCGTTCAA
GACGAGCTGAACAAAGTTTCTGGACTCGTACCATACAAGACGCTCGTCGAATGCTACTGCAAAAACTTCCTCGTTGACCAGTGAGTTCTTCGCAACTTAC
AGATCTCCAGTATGCTGCCGGATCTAACCAAGAATTGTACTGCGTGTTTTGCAACAGCTCTTTCCGAAGCATGATGTACGAAAGCTTCAACAATCCAGAA
ACGGGGGAGGATGAGATGCTGTGTCGGTCGTGGGCAACAACGTTTGTGACGACCCAGGTCCTGTCAATAGCttctgtgctgctggtcgtggcaGTGAATC
TGATACTGGCACGCATTCTTAACGGACTTGTCGCCTTGGAGAAGCACCACACCGAGTCTAGCCTGATTGTGTCACGCGTTACCAAGGTCTTCCTCGCTCA
ATTCTGTAACACAGCTCTGCTAATGCTGGTTATCAACGCGAATGCCAACTATTTCTCATCTTCGGCCACTGTATCGGAGACAGGCACCAGCACTGGAGGG
TTTTCGCTCGGAGCGTTGCAGGTTCTTAATGGCAAGTACTCGGACTTTTCAGCAGACTGGTTCAACGACGTCGGCGTGGCGCTCATGCTCACCATGATCA
TCAACTCGTTCAGCACGCACGCTTATCTCTTGGCAAACTACATTATGCTCAAAGCACGGCGCTTCATCGATCGGGGGTATTCGTTCGATCACTCTCTCAC
AAAGCAAGACACGCAACGTGACCTCGAAACGCTGTACCGCGGACCGAAGTTTGATCTCGCTGCACGCTACGCTCAATCGCTCACCTCGATCTTCATCACG
TACATGGTACGCCTGCATTGAAAAGATGTGAGCTTTGAGCTGAAAATTAACCCTGGTGGTGGCAATGATTTTGTGTATCTCGCGTTGTAGTTCTCAGCAG
GAATGCCGCTGCTCCACTTTATCGGCTTTGGTGCAATGATCCTGACGTATTGGGCTGACAAATTCAGTAAGTTACCCTCGTCATGGTCTTGGGTCTCTGT
AGACATCGCGACTGACATGATCTTTGGCGTCAACAGCGTTTCTTCGGATTGCTCGGTCTCCACCCCTGTACGACAGCAAATtagcgacagcagcaggatc
tcTGCTTCCCTATGCAGTGCTGATGCATTGCCTCATTGCCATGTGGATGTTCTCCAACGACCGCATCTTCGAGTCCGAAAGCGACGAAACCTTCGAGGAC
GCCATCGTGAACAGCACAAGTAGCCCTGGTGATGGTATCCCCCTGTTTGACGCCGCCCATCGAGGTCAATTGATTTCCCGTGTCACGCGTCCTCAAGTCG
TGGTCCTAtttgccttcttcgtggctGGATGCGCCATCGTGATCATGCGCACCGTGCTCTTTGGGTACGTGCCAGCTCTGGTACGCAGCGTCTTCCCAGG
TCTAGCTCGTCTTTTGGAAAAGCCCCGTGTTGCGAAGGGCATTCCCAACTACTTCGACGGTGTGTGCACAGCCTCGACCTCTTGAACGATTCACTTCATG
CTCTAATTGTCTTGTAACCATGTCCATAGCCATTCCGACCCCGTGTCTGCAGGACAAGCTAGCTGCTACTGGCGGCACGCAACAACTTTTGCGACCGGAC
TTACGAGCCAAGTACGAGCGAGCTCTGCTTAGTCGCATCGAACAGGAGGAAACTTTGCCGAAAAAGCGATCGGTGTCTGCGACAGAACGCTTCAATCAGG
CTCACTGGATCGTCGGCTGTCATTCGTATGGTACGTTAGTTAGTCTTGGCTTAGTCATCGCTGAGCACAGCACTGCTAACCGGTTTGTTATCTCTCTCAT
TGCAGCCATCAGCGACAACAAGGAGTACGTCGCCAAACTTGCCATCGACTCGCATCTCTCGGAAGAAATTCCACTCGATCAGATCTTCTAGGACTCTGCC
GGCTGAACTTGCACACTTGAACACACGACACACGGCTGGTATGGTACACGCGCTCGACGTTATTAGCGGCTATATTGtgagaaagcagcatctttccCTA
CGCAATTCCTATGAACTCGTCATGTAGTGCCATTCTCGACACTTGCACACGGCCTCTTGAACGCTTGTATGGTGGGCTGACTAGTACGGTGCCTTGGGAG
ATGGCGAGGATCCGTCTGCagttgacgacgacggcgactgCACACGTAGGCCAACTTCCGAGAGATCCGACAGTTGTCCTGCTCGAGACTGGCCTCGCGT
ATTGCTGCCCCGGTAGATGCCCAGCGCCATTTCGGTCTCGCCGGGGCAGTGCGAAAATGCAAAGCCAGTGTTGCGGCGTACAAGGCGCGGCGAGTCCATC
ATCACGGCGGCGTCTTCGCCCTTGGCCAGACGATTCCACTCGCGCATCAGGTGAGATGGCTCCGGGTAGAATAAAACTCGTCCGGCCTTGGCGATGTAGT
TGGgcaagatggctacaacTACAGATAACAGGAGGCCAAGCCAAAACCACGCCTCGCGTACAAGCTGGCCTACCACACCATAGCCCACTTCTGTATCGTA
AAAATCGGCCTTGGTCCACCCGAATACAGCGCAGAAGAATGCTGTAAACAAGTAGTAGAATACTAGCGTGCCGACAGTTGAAACGGCGTTTGTCCGCGTC
CAGTTGCTCGTCATGAGCGACACTTGCACCGTCGAAGCTGTGATCAGGTACGTGTACGATGCGACACCGTTCGCCCAGAGTCCCATGTCGCGCTTGTCAA
ATTGGAGCTTCGACGATTCACTCGAGAAGTACCAGACAATGGAACCGTTTGTGAAGAACGGCACTGCGTACACCACGTAGGCATGCCACGCGCCTAGCAC
ACACCAGCCGAAAAAGGACAGCCAGTTGAACGACCGATTTTTCAGGCCGTTCACGTACAGCGTCGGGTACTGCATCAGTACTGCAGGAGACACGTCCTGG
TTGTACATGGCAATAATCACGATAGGAATCGTCGTAAAGAGCGCGTTATacagcgtgaagaagatgctgaaaTACATCAGCACACCGCTGTacatcgtct
ccatcgccaaGAAAAAGTTGGACATGGATAATGCCACGTTCTTCATGAAAGAGAACAAGATGAGCTTGGAAATCCTCTTGTAGCTGTAGTTGCCGTGCAC
CAAGAGGAGGCGCTTCAAATACTGGAACTCGGCAATTGAATAGTCGCTCGAGAGAACAGCTTGACGGCCCTCTTTTCCACTAATACCGACACCCACATTC
GCGGCCTGGATCATCGGCACATCATTAGCACCGTCGCCAATGGCAAGCGTAATATTGCCTGGTGAGAACATGAGTGTGGGTTCCGTAACAAGCTTCACCA
CCGATGCTTTTTGAGCGGGTgaacaacgacagcaaatCACCGATTTGCATTGCGTAGCCACAGCCAAGAAGAGGTACTTGATGTCATCATCTAGCACCAG
CGCAAGCGTTTTACCATCAATCACCATGGCAAACTCCAGTTCCTCATCAATGTAGTCGACACTGCTCATGCTGCCAGTGCCGCCCGTCATCGCATCAGTT
TTTGGCTCAAAGTCGTGGTCGCACAGATCTCGGTCGAAGCTGTTCTCAGATATGTCGCGGTTTGGTTGGGCCGCCGGATACACCTCGTCATAGTGAACAG
GACTATCAGTCGGTGTTGCATCAGCACCGGCGTGCTCGCGGCGTGGCAAGCGTCTCCGCTTCTTTCGAGCctccgcttcttcgtcgcgtcCCACCAGAGC
CAATTTTACGAGATCCCACAAGTACAAGATAGCTCGCTTCAGAGCTTCCCACAGGACACTTACCGCCGACGAGGTTTCATCTGATCCCCATTTGTCCTCA
ACAAGGTCGACGTACAGCTCCTCCAGTCTTGTACGTAGGGAGCCCTTGTCACGCTGGCCCAGCACGATTACATCCATGTTGTCATCAATCACATGCGACG
ACATGCCAATGCTCAGCGCAGTTTCCTTTTTGTCGCCCGTGAGCACCCAGAATTTAATTCCCGCCTTGCGCAAGGCACAAATAGACTCCTCCACGCCGTC
CTGTAGTCGATCTTCGATGGCCGTCGCGCCGAGCAGCGTCAACTCAACCTCAATAATGGCCGAAACCTTGGCAATCTTAGCGGCACGCCCCTCCATCGAG
AATTCTGCCTGGCGGTACAAGTGGTTCCACTGGTCGTACTCCTCCTGCGTAAGGTGACGCACAGCAGTCGTCAAAGTTCGAAGACCCTCCGATGCATATT
CCTGAAGATGACCACGTGTCACGTGCGCTACGCCCTGTGGCTGggacttcgacagcagatCGAAAATCACGTCATCGGCGCCCTTGCAGTAAAGCACGAT
ACTCCCGTCGGGGAATCGCACAACTACCGACATGCGTTTCCGGTCGCTGTTAAACTCCAGCACATTCAGAATTTCAAACGACATGGGCCTGCCCTGAATG
ACAGTATTGCACATTGGACCATCGCGTGAAGTGAGCACGTAACCGaggtctgcagcagccagcacaagcgcttcttcatctggagAAGACGCGTTGTATT
TGATCATTGGAGTTTGGGTCGAGCACGAGTCGCTATCCGTAGGTGACGTAGGAACGTTGGTCTCTGGGATCACGGTGTTGCAAATCGTCAGCAGTAACAG
GAAATCATGGATTTCCTTCTTTGTCGAGTGGTTCGAGTTCAAACGCGCCAGTAATCGGCCGTCGTTGAACTTTGTGCCAGGTCTAGCATTCTTCGCTGGG
TCTACCTCAATGTCATTGTAGCGCAGTCCCGCTATGGTGCACTTCGCAAAGATCATTTCGTTGCATGTGAGCGTACCCGTCTTGTCGGAGAAAATATACT
GAATCTGTCCGAGATCTtcgttgatgttgctgttgcgaACCTGTGCTGGTGTATCTGTCTTGGTGTCGTAAATTTCCAAATCATTTTCGATGTAGCGTGC
GTGAACAAAACGCACGCCTTCCATCGTCACATACATGGAGAGCGGGATCAAGTTGTTAAACAGGATCACGTAACTCAAGAAGATGTAGCCGTTTGAGTCT
TCCTGAATGTACCACGGTGTCGAATCGTCGGCCAGGTCCAAGTTCCAGTTGTTGTTGCCTAGCGTGCAGGCAATGGAAATTCCGAAAAGTAGCATCAGAA
CCAGCACGAACATGGTATCCAAGGTCTTCTCCACAAAACTACGCTTCAGCGGCACAGCGACCGAGTTCATCTGGACCTTCGTCTCCTTGCCGGTATAGAT
CACAAGTCCAAGCGTCCACTCGGCGTTGCGGCTTTCACTGCCACGCAGAATCAAATTGTCCATAGTCAAACTGGTTTCGAAGTCCTCTTTGTTGGCATCC
ACAACAGCATCGTCCGCGAACTTTCCAAGCCTTAGCACACCGTCAAAGTAGAACAGATCCTTGTTGGGCACATCACACTCCACCTCGAGTTTGTGTCGCT
CCAAGATCTCTTCAGCAGTAAGAAAATGCTTTGTGCAGCTGGCTACCTGGCGGATCTTCAGGTTCGTTTCGCCATCCAGGTTGGCCGTCTCCACGTAGCA
TCGGCCATCAGGCCGGCTTGTGGCCAACAGAATGCAGTCCGCAGGAACCTGATCGCCGTCTTTCAATACCAAAACATCTCCCACCTCGATGTCTTGCCAT
GTGCCATCGATATGCAtcacctcgtccaccacaTCGCGGCGAACAATGTGCGCCGGCCTAGAATTCACCATGGCATCCCCCTTCTGCCGACGAAGATCCT
CGCTCACGTCCTTAAGCGCGGACGTCGCGAACACAATCAGCAGTGGCGTAAGACTAGCTACGGGACTCACCGGCGAAAAGTCAAAGAAACACAACGCCAC
CACGATGGTCGTGTACAGGTTCGCCAGTCGGCTGAACTGCATCTTGAGAAAGACGAACAGGAAGTTGTAGTACGTGTACTTACTCGTGATGATGAGGTTG
GAGCAGAACACGGGAGCCTCTTCCTGCACCTCTGCCTCCTTCCTCCGCTGCGTCTTGGTTTTCAAGACATCCGGCAACGTCGCCGACACACCCGACTGAC
TGCGTTGCAACCTGTTGCTCGGGATGCCGGGCCCCACCATCATCTTACGACGTGCCGACGGTCCGACAtcgtcctccatctcggcGGCGGACGGGTTAAT
AGACAGCGTCTGGTGCATCGAATTGACCCGCTGCGGGGATGGCATCATTGTGGCGAGAGCGGCGCGGTCGCATTCTCGCTGGTTCTGCACCGCCTTAACG
ATGCGCCTGAGCTTCCAGCCGTACATGAAGCCCGTGATGTTGAGCATGGTGAGCaggatggagaagaagccctGCATGAGCACGGAGGTGCCGCTGCTCA
CACTGTTGAGCTTGCCGTTGTAGCCCTTGTAGTACCAGATGACGTCCACGAGCAGCGTGAGCTGCATACCGATCTTGTAGCTGAGCAGGAACTTGGGCAC
GAGGAACTTGGTGCCGTGCCAGCCCAGCACGAGCGTGATGTACAGGATGAGCACGGGCACAGTGGCTTGGAAGCTCAGGCCCAGGATGATGGGGAAGATA
CGCAGCGAGTTGATGATGGTCTGCGACACGATCGTGAACTTgaggcggcggcgcgtcTGGTAGATGGTCATGCCCTtgaggaagcagaagaccTGCTCGA
AGAGGTTCCAGAGCTTGGTCTCTGCGTTGGGCTTGGTATCAGATGCGACTGAGTCGGCCATACTGTCGAAAATGAAAAGAAAAATGTCGAAAATGTGATT
AGTTCATCACGTCGTTTTTGACCGAAAATGAAAGTCCCTCTCTGTTTTAAACGTTGTGTAAGTTACCTGTCGGCTCGATACCGCAGCGAGATGATGTTGC
GCTGTTCCTCCTCGTTAGGCATCCCGTTGAACGTGTTGACACGGCGCAGGTTCTTGTGATTGtgcgactgcgacgtcggcggctgcgtggccagcgcctG
GACGCCGTCCGCGGAGGAAGGAGGCGCCTGGCCGCCCATGTCCAGTTGGTAGTCTGTCGAGCTGTCGGACGGCGAGGGCACCGCGAACTCGACGTGCATC
TGTCCGTCGGTCCGTTGGGGGATGGAAGCCCGAGTCGGCCTATTCTGAGCTGCGCTCTGGGAAGGAATATGAGAGCTGTCGCGCTGGCTT