Description :
From Genome Similarity Track
Location :
Scaffold_210:15777- 17956
Sequence
2179 bases(100 bases per row)
TACGAGCAGCCGAACAATCAGCTCTACAATTTTACGGGTCGTATTCACCTCGACAACAATGCGTCTACAACTCCACTTGGCCCAGAAAATATTATGTTGC
GTGGTTGTGGGCTACGTAGTTGCTCCTTCATCATCGGTATTGTCATTTTCACTGGGGCTGAAACGAAGCTTCTCCAGAATTCAAGATCTGCACCATCGAA
ACAGAGCAAGCTCTACAAAACTGCAAACCGTTGTATGTTTCTGATcTtCTCCACcATGTTtGTGCtGTGCTTGATCAGCGCCATtGTCGCCGCCGCATGG
AACAAAAAcAACGACAGCCGTTTGTGGTACTTGACTACCGTGAAGAAGAACGATTTtGCTGGGTTCATCGTGAATTTCTTCACATTCTTGATTCTCTACA
ATAACCTTGTTCCGATCTCATTGTACGTATCTCTTGATATCATCAAGGTCATACAAGCTCGCAATATCACGATGGACGATGACATCATGGATGAAGGCTT
CCGGGCTATATCGCGCACGTCGGACTTGAATGAGGAACTCGGTCAGATCGAGTACATATTCAGCGATAAAACCGGAACGCTCACGCGCAACATTATGGAA
TTCCGCAAGTGCTCAATTGGTGGTATCTCGTACGGTTTTGGCACAACGGAGATTGGTAGAGCAGTTGCTGCCATGCACCCTCcGACAGTACgAGGTGGGA
GTGTTGAACTGAGCATCGAAAGTACCGAAGGTGTTGAGTtGACAACAGCTATTGGGGTgAAGAAAAGTTCCAACTCTCCGGTATCTGGTGACCCATCGGC
CGCACAGGTACATGTTGATCCTACGATTAACTTCGATGATCCAAGGTTGTTAAAGCATTTGTATGCTGGAGGTGAACAAGCACAACTCATCAACGAGTTT
TTGACTCTCCTGTCCATTTGCCACACCGTGATTCCCGAGGTGGACAAGAAAACtGGAGtAATGCAGTATCGAGCCTCATCGCCCGATGAAGAGGCACTGG
TAAAGGCAGCCAAGTGTTTaGgCTACAATTTTGtCGAACCTGCTCCATTGACCAAAGTGGAAGTTGCGACGAAAAagTtcAGTCACAAGAAAAGTGGAGG
CTCCTGTTACAAAGGAATTTACTATTCTCAATGTGAACGAGTTCAATTCGACAAGAAAACGGATGTCCATTGTCTTCACAAATGATCAAGGtGATtATAT
ATTGTATTGTAAGGGAGCCGACAACATGATGCTGCCCAGGTCAAACGGGGATGCATACCTCtCGGCCGTGAACGATCATTTGCAAACCTTTGCAAGTGAA
GGGCTGCGGACGCTTGTTCTCGGTCGTCGTGTATTATCTGCTGAGGAGTACGAAGCTTATAATAACCAGTATATCGAGgCGTCcACTTCACTGGATAATC
GCGAGGCCAAACTAGACGCAGCAGCGGAGTCAATCGAGAAaGATATGACGATtGTTGGTGTCACTGCGATTGAGGATAAGCTACAAGACGGAGTTCCTCA
GGCGATTTATGATTTGGCTCAAGCTGGGATCAAGATTTGGGTTCTCACTGGTGATCGCGAGGAGACTGCTGTCAATATCGGCTACGCTTGTCGTCTCATC
AACGATCGCATGTCTCTGATGTATGTCAATCAAGAAAaTATTGATATgCTTGAGCGCCAAATTGATGAGCTGCACGGATCAACCAGCATCCAACAACTCA
TAAGAAGCAAGAAAGTTGCGGACGAGCTCGCGATGGTATGTGATGGTAAaGCACTTGTGCATGTGTTTCCATCCAAAGACGCAATGGCCCAGATGTCGTC
TGAGAGTGTAACTCGGCGGAGAATGCTCGCTGCGAAATTGCTCGATGTTGCTAAAGTGTGCAAAGCAGTCATTGCATGCCGAGTAAGTCCATCACAAAAa
GCAGATATTGTGAATCTTGTCCGGAAAGGTTGTCCcAATCAACCGATCACTCTCGCGATTGGCGATGGTGCAAATGACGTCAGTATGATTCAGACAGCGC
ATGTTGGTGTTGGTATTTGCGGGAAAGAAGGTGTTCAAGCTGTGAATGctAGTGACTAtGCTATCGCACAGTTCCGCTTTCTGAAGAGATTGATGCTGAT
TCACGGCCGCTTCAATTATAAACGCGTGTGCAAGGTCATCCGTTACTCGTTCTACAAGAACATTGCACTTGTGATCAGT