Description :
From Genome Similarity Track
Location :
Scaffold_112:15775- 17385
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_112-snap-gene-0.22Oxidoreductase, 2OG-Fe(II) oxygenase family family protein
Pytap_DAOMBR444maker-pag1_scaffold_112-snap-gene-0.23Solute carrier family 38, member 7

Sequence
1610 bases(100 bases per row)
TCAAaGGACAGCGGTACCTCCACAcACTGTTTCTGTCGtcTCCGCGCGCCGTCGTTTTTTCCACTACGTTtCCGCTTGCTCGTCATCTATCCCTTTCACG
ACTGTGAACGGTCTCATGTCATGATGCTCCTTCCTTACCTAGTTTTAGCATCCTATCAGTGCACTTTCCCGCCAAGAAGAACATTTCAGAACGATCTTGG
CGCCATTGTTGACCATGTTAGCAGTTACCACAGATTTCCATACAACAtGCAGTGCGCCATGATTCTTCAGTGcTCTTCTTACGTTGATATGCCGTGTATC
cATCAGTTCGCCACATCTTgTGACGTTGACTCGGTTTGCACCTGCACAGCTGTGGCCACGACACTGGCGGTGGCTCCCACGACCCCAATGACAATACTAA
GGATCGGCAGAACTCGGTCTGAGCACCAGCTCTCGTAGGTGTCCGCAAGCTTCAGCTGGCACGCTGCTGGAACGATGAAGCAGAGTATTATCCCAGCTAG
CCCTCCTGTGAGCGACAGCACGACCCcAGCATCcGCTGTACTGAAAATTGCAACTTGTGCCACGAGAACAAGCACGACGAAGCTGGACGCGTATGAGGTC
CACGATGTTTCGTGGTCCTCGTAGTACAAGTGATGGCCAGGTGAAGTCTTGGAAGGTTGCTGGGAAGTAAACAGCACATCGTGTTTTTCACTTGTGGGCT
CCTTGCTTCGCCGgCAAAGTAACTGGGCCGTATGGCGCGAGATTATCATCTTgAATCCACACATtGAAAAACaCAAaTCAGTCAATGCAGCACACAGGTA
CATGATCGAGCACACACCTCAAAAGAAAaCATCCGATTGCAGCAACGGGCACAAGAGACCAGAATGGAAGCAAGAGTCGGTTGTTGCTGAAATCGTAGTT
GAGCAGCACGTCGCTTTTtGTGCTACCTAAgAAAGATACATAGCCACCTATTGCGAAAGtGAGCCCGATCGCAATCGATCCTAGCGTCGCAATCGCTGAG
AGTCGTTTGAATGTCGCTGTTGATCGATCGCCCATCGCGTAGAAAGCATGGAAGCTGTGGTGCTGACTGACAAGTGACATCGTGATAACTGCAAAGGCTT
GACAGATtGTGGATGGAACATCGAGATAATCACGATCATAGCCCTGAGATGATTTGTCCGCGTTGGCTTCATGGTCAGCCctGGCTTTCACTACCACACT
GTAAgAGGCAGCTACGAGTGCTACACAGACGATGACAGGTGTCACCCGCATGCGCTGATACGAGTTCACGTACAAACAATACGGGATAATCACTACAAGC
ATCTAAACACAACTTTGAGTCAGCACACAACAACTGCACTCCATCTACGAAAGCACAGTCACTCACGAGAGCTTCGGCGAACCAATACTTGTCGGCAATC
AAGGCGCGGAGCGCAGACTTTTTCGtCCCTGGGAGAATCACAGGTCGGCCATCGGCATCGAAGTCCATCTTAAGCCAGTGACCAAGCAAGATCGGACCGT
CACGAAACGCGGCAATCAGATaGAAAACCATGAGTCCAAGAGACGTCCCGAGTTGTGTGGCAGCCACAGTAAAAGCaCCAGCAGGTCCAAACGCAAGCTT
CGCCAAGCCT