Description :
From Genome Similarity Track
Location :
Scaffold_6:1577053- 1578114
Sequence
1061 bases(100 bases per row)
TTGCATCAAGGCGCAACCAATGGCAAAGACGCTGGCGTCGCATACCACGTGAAATGGCTTGGAGTGGTCAGGCAGCATCAGGACGGGCGCGGTGGATAAG
CTCGTTTTTACCGCGTCAAAGGCAGCTTGATGTTCTGGACGCCATGTCCAAGTGGCATCGGTCTTGAGTAGTTGCGACAGTGGACGAACTGTCGCCGCGA
AGTTCTTCGAGTAGTGATGGAGATACGTCGCGAGGCCGAGCCACTGTCGAAGCTGTTTCGCGTCTTGAGGAGATGGCCAGGCGCAGATGGCTTTTACTTT
CTCGGGGTCAGCACGGACACCGTCCTTGCTGACGTAGCTCCCGAGGACTGGAATCTCGGGGGCGCAGAAGATGCATTTCTTCAGGTTGGCGTAGAGCTTG
TTTTCACGCATCACTCCGAACACCGTTCGTAGGTGTTGGAGATGAACTTCGATGTCAGTCATGCCGGCGTCGGCCTGACTATGAATGAAGATGTCGTCCA
AGTAACTGGGCGCGAAGTCGCGATATGGACGCAGCAAATGGGACACCATGCGGTTAAAGGTGGCGAAGGCGTTCTTGAGCCCCTGCGGCATGACTAGCCA
TTCCCACAGCATTTCACTGGGCGTGCTGACGGCGGTCAGCGGCACGTCGTCTTCGCGCATCAACATCTGATAGAATCCGTCCATCAGATCAATCGCGCTA
AACGTGGTGCTGCCTGACATGGAGTCAAGAATCATGTCCTTTCGTGGGATCGGCGTTTGTGCCGGGATTGTGGCGTCGTTAAGCTTGTTGAAGGCGTGGA
CGATCCTCCACCCCCCGGTCGCTTTCTTCACACAGAACGTAGGACTGGAGTGGGGTGACAAGCTCTCGCGAACGTGGCCGGCTTGCCGGCGACTTTCGAA
AAAGGCATCGATCGCCTCGACTTGGTCGCGGGGAAGCGGCCACTGTCTGGTGACACAGTACTTGGCGCCAGGCACGAGATCGATCTCGTGTCGGACTCCG
CGATCCGGCGGAAGGGCCGCCGGAACCTTGTCGGGGAAGATGTCGATGAATTCACGGACGA