Description :
From Genome Similarity Track
Location :
Scaffold_131:1577- 3448
Sequence
1871 bases(100 bases per row)
GCCGACATCCATCAATCGCAGTAGTGTCAGCTGTTTTGCCAGATCACGATCGTTTAGCGTAGCAATGAAGTGATCCACATGTTCGCGACGTGTGGCCGAA
GTAGCCAATATTTATTCTTTGATCGCGATCTTGGCGTGCTTTGCTACAACATTAAGGCGATGCAAGTAATCCAGCGGGGTTTCATCTGATCGCTTCCGTG
CGAGATAATATTGCCTAGCCACACACACCCTTTGCCCTCCATACTAATAATGAATCAATCCAGCAATCACTTCCACTTGTGTCGAGTAGATCCACTCAGT
TGGTTGTACTAGTTTCGTGCTGATCCTATCAACAGATCTCCGAACACCAAACAATATTCTTCGTCTGGTGCCGGATCGCGCAGGAACGCCGACTTGACCT
TGCTGATCCAGCTTCTGGCCTTATCTTCATCTCTGTCTTTGCCACTGAATTCTTTCAGCTCCGTCATCGCTGACACACGAATACGTTAAGGAATCCCACG
ACCATTCTGCAAATTACTGCGGTGGCCACCATCGCACGTCTCCCCTCTTTTTGACCCGAATCATCGGGATCGACGCCTTCCGGGTCGAAAATGGCCGATT
GACTACGATGCGATCGGACCGATTACATCTCGACATCTGGGGTGTATGCTTCCTGAACTCTTGTAGCATTGGTTCTTTGGCTAGAATAGATCGCTTGATA
CGCTTGCTCCCCTTTTTTGTTGAAAACACTTTATGGCCTCATCGAGGTACGCCTGCATGTGTCCTTGCGTAGTCAAATTCGTATCTCTTTTAGCACGTGC
GTTATTCGATCGTGGTTCGGTTTTGATCGTTTCAACCCGATCGCGCAGATGCGCTGCTCCACTTGGGCCTAGAGAAATCTGCTGAATACCGATCGAATTA
TCTGACTCGATTTCGGATAAAGCTGACGCGTACTGCGACGATCCGATGTGGTATCCTTTCGGGGTGTCTACGATCGCTGCTTCTGCTTAATCCGTAGGAT
CACACTTACCCGTTCGGGGAATTAACTTGTTGTACAGCGATTGATACGCAAGGTTCACCTGATGTTGATCGCTTTCCACAATTTGGTATGCGTCGAACAC
CCCTGCGACAAAATCAGCGTCATGTAGCAGCCGTATGATCCCGTTGATCTCTTCCAGTATATCAGACGCTATTGCCGGTGGGGGCATCGGACCTTGGATT
CCTCCGATCAGCTTGGGCTATACAATCCGGAGCACTGTGTCACTTGATAGAAGATTATTACGTTACTTCCAGTGGTATCCCTCCGCCAACTGATCCAGCT
GCCAGCCTTCCATCTTCATATTGTCGCCCACGAACTTGATGGGTCGGTTGATCGATTTCAAACTGCGATCGTGCTGATCCGATCTTGTCGCTTCTTTCTT
CACTCGTGCTGTCTTCACGTTCTTCGTCTTTTATTTTGCTTGAGTGGTCTTGGGTGATAACTGTTCGGGTTTATCCGAAGGGTTTTCAACCAGCAGGTCG
TGCTTTGCGGCACGATCCGCGGTGGTCCCTGAAGGGACCTCAAGAGGGGGTCGAGGTTTCTCTTCCAGATCGAGAGATCGATTTTCCTCTTTGATTTTAT
TATCATCAGAGCCGCTTTCAAAACGCCGATATCCTGATGATTCTTTAAGAATCACGCATCGGGGGCGATCCCACTGTCTCTAACGCTTCCATCCCAGGTT
CTGTATTTATTTTCATCTCTTCACTCCGGGACCACGGTGAAATCCCGAGTCACCAGAAGTTCTTGGCATGCGCACCATTGTGGTGGAGTGGCAATCGCTC
ATTTTATGAGGTGATCCCAACTCTCCACTGGTGCCCAGACGACCGACTATCGGGGGGGGGGGTACGCCGTT