Description :
From Genome Similarity Track
Location :
Scaffold_328:1577- 2878
Transcript NameFunction/comments
g10814.t1hypothetical protein
g10815.t1POM73630.1 Reverse transcriptase [Phytophthora palmivora var. palmivora

Sequence
1301 bases(100 bases per row)
AAGGTGGACACCAAGGGATCACGCGGACGTATGAGAAGCTTCGTTCTGAATTCTACTGGTCCGGTATGTATGCCGATGTTGAGAAATTCGTCAAGGAATG
CGTAGATTGCGCCAGCGGCAAGGGGCGTCCTCCAAATCCTGGACCTTCGCCTGGAAACATTGAGCCCAGACGACCGTTCGAGGTTGTGTCCATGGATTTT
GTGACACACATGCCTAAGTCGGACCGCGGAAACACTTTTTTGCTCCTATTCCAGGACATGTTTTCGGGGTTCGTGATGTGTAAACCCATGAGTTCTACGA
CGGCCCAAGATGTCGCTGAAGGTCTATGAAGAATGCGTATTCAGGAGGTTCGGAGCGAGTTCTATGATAAGACATGACCAGGATCCGAGATTCATGAGTG
AGGTCTTCACGCGATTCCGGGAACTCTTGGGTAGCAAGCAGCGAGCCACTCTGGCGTATCGCCCTCAAGCCAACGGCCAGCAGGAGAGATCTGTGCAGAC
TGTGGTGCGAAGCATCCGCGCGTACGTTGCGGAAGCCGACCAGAGTGACTGGGATGATCATGCAGAGCGACTGATGTTCGCTCTCAATTCGTCATTTGAT
GCAACGAGACTGGATACCCCCTTCTTCCTGGTGCACGGCTGGGACGCACACGGTACGGTGTCTGCTATGCTTGGACCCAAGCCGTCGAGCGTCCAGGAAC
GCACTGCGTATGACTGGCGTCGGAAGTTGCAGCGTGATTACAGCTACGCTCAGGCTTGTGCCAAAGACCTGCAAAAGAAAGCTAAACGCATGCGTTCTGC
TGAGCAGACCAGGAAATGGAAAGAACTGTCCGAACGTTTGAGAGCTGGTTTCGCTGTGGGCGATGCTGTCTGGTTATATATACCGAAGGTGCAGCCCGGA
CTCAGCCGAAAACTAGCTCACATGTGGCATGGTCCATTCCGTATCCAGGAAATGCACGACGACTTCAGAGTGAAACTCAGGATTGAGAACTCAGGATATC
GTGTTAATCCCTGGGTGCATGTGAGTCGACTAAAGCCTAGAGCATTGTTCCCAAAGCGACCCGATGTGGAAATAGACGTGGAGGAAGATGACGATTTCGA
CGCAGCCTTGTTACCAGAAGATAGCTGGGAACCTGACGTAGAAAATGACGAGTATGAAGTCGAGCGAATTCTAGATTTACGCTGGACTAAGAAAACTCGG
ACATCAAGGCGCTCTCGCGAATACCTTGTGAAATGGAAGGGCTACGATGAAACGGAATGGTTACCTGTGTCGAGGCTTAACTGTGGTGCTCTACTATACG
A