Description :
From Genome Similarity Track
Location :
Scaffold_85:15769- 18390
Transcript NameFunction/comments
Phyta_totarag3227arginine biosynthesis bifunctional protein argJ, putative
Phyta_totarag3228hypothetical protein PHYSODRAFT_307583

Sequence
2621 bases(100 bases per row)
CAGCGTTCCCGTATCCACTCGCAGCTGAATGACTTGCTCCATGACGATTATTCATGACTAATCTACGAGCGGTAGTCGGCGTTAATGGCCACGTACTCGT
GCGTAAGGTCAATGCCCAGCACCTGAGTCTCGTCGGATCCAACACCCAGATCAATTTCAATCTGTGAATACGAAACAACATTAGTTACCGCTACCTCATT
AAACACCAATAGGAATCGAAAGCAAGTACATACCTCAACAAACTTTCCGTGCGGAGGGAAGTTGTGCGAGCTGGCGTCGAGTCCACCGCGGGTGGGCTCA
ATCAGCATCGCGTCGCGCATGTGTGCCACAAGCTTAGCCTCGATATCGTCGTTCAGCACCATTTCACCGTTTTCAAAGATGACAACGCCGCCCATACGGA
TCTTCATACGGCGCTGAATATTCACATCCTTGTGGTGCAAGCCCATGTACTTGCCCACAGCCATGACAAGACGGCCCACGTTCGGGTCGTTGCCAGCCAC
TGCACACTTGAGCAGAGGCGAGTTCACCACAGACTTGCCGACGCCCTTGGCCATCTCTTTCGACAAAGCGCCACCCACGCTAACCCGCATGACGTGGTGC
GCACCCTCACCGTTGCGCACAATGTCTTCACTCAGTCCGAGGCACACCTcgtgcagcgccttcttgaactcgtccagctgcttcatgtcGAAGGGGATCT
GGTCCGACGACACGAGCGTCACCGTGTCTGACGTGCTCTGGTCCGTGTCCACACTGAGCGAATTGTACGTGTCTCCAACCACCTCCGTCAGCAACTGACG
CAGCACGTCACGCGGAATCGACAGATCTGCATCAGACGTTGAAGAATGTCAGTCCACCAAAAAGTATCCTCTCCCCAATGACGCAGCTTGCTCACCCACC
GGTAAGAATGTAGGACAGCATGGTAGCCATGTTGGGCTCGATCATGCCGGCGCCCTTGGCAATACCGACGATGCGGCCGCCGCACACGTCGATGGAGCGA
ACCTTCGGGTACAAATCTGTCAACAACAGGTACAGTCAATCATGAGTCCAAAAACTCTTAACAAACAGCACAAAAGGTTTCGACGTTGCAGCTCACCGGT
AGTCATGATCCCCTCGGCAGCAGGCAGCACCGAGTCGGACTGCAGGTTGTTCACGAGCTTAGGGAGGTTCTCCACCATGGCGTCCACGGGGATGCGCCAT
CCGATGACGCCCGTGGAGCAGGGCAGCACCTGCGTGCCTCCGTCCAGCCTCAAGTGCTTGGCCAGGTTATCGCAGACCTCCTCTGCGTCGgccacgccgc
cgccactggCACAGACGTTGGAGATCTTGTTGTTGACCAGGATGGCGCCGAGCGTGGGCTCCTGCAGCCGCTTGCGCCCCACGAGCACCGGCGCTCCGGG
GAAGGCGTTCTGCGTGAAGACAGCGGCGAACAGAGGCGTGGGCTTCACGGGCTTGATGAGCGTCATGGTCATCTTGGCTGGGAGGTGGGGCGCTTCCTGC
GGGACAAAGTCGAACTTGGTGGTGGCCACCGAGAAGCCCCAGGGCAGGCGGCTCTGGTGCGTCTGCAGGTACTCCGTGTACTCGTGGCGCGACTCGAACA
CGAACGGGTGGCCGTGGGTGGACAGGCAacgcgtctgcagcagcgagcgcgagcggGCGAGCGACGACAAGCGCAGGATCGTCATGGCGACTACGGACGC
GGAGGTTCGGAAGGGGGACGCCGCTTCAATTGTGCACCAGCGGTATGTGCGCAGTTTTACCTGTTTAAAAACGGAGGGCCCTACGGTACTTTAGATCTTG
ACTTCAGTAGGGATGAATTTTTCCTGTGGCGGCAAGAGACGCGGGAAGATCCGCGAGTGACCAATCACGAAGCAGGATGCAATTTGTACTGTACCAAATC
GTAAAATGGGAATTTGTGCACACACAATTGCATAATCGCAGTTCGGAGCTCATGGTGCCGCCGCCGGCCGACGCCGCGCCTCCACACGAAGACGGGAACG
ACTCGGAAGCCGCTTCGGACGCGCCGCTGCCTCCACCGCTGCCcccgcctcctcctccgcaaGTGCGTCCAGAAGatgagctcaagcagaagaagtggCC
GACGCAGAACCCCAGCCAAGTgcagaagcccaagaagagaaaAGACTTTCGCGAGATTCTGGCGCTTTTCCACGACGAGTCGATGGACGCAGCGAGAGCC
AAGCGCGTGTGGAGTTCACTGTGGCAGACAACGCTGGTGGAGAGTCAGGAGGACCACAAGAAGCGTcggcagcaggagcagcacggcctcaagcggaaga
agagcggGGACCACGACCACGGCCCCATGTCCGCCAGAGGAGGGCCCGGCGCTCTTTCTCGCCACGGCAGCATGACCCAAGACCATCTTAAGAGAGCACG
GCAGGTCAGACTTTGTGTCGTGAAAGCAGCTGGTCTGTCGGTCTTGTTTTGACGGGgtttttgtgtgtgttgctTTGCAGGGCTCTACAGCGAGTACGGA
CTCGTCCGAGTCGGGGAAGGCCAGTCGACTGGGAGGACGCTTCCCCAAGAACGTCTCGAAAGGATCCAAGCTCATGCACAAATTCAGCGGCCGTACTTAA
GTCAAATGTGCGTAATATATA