Description :
From Genome Similarity Track
Location :
Scaffold_417:15768- 22920
Transcript NameFunction/comments
Phyag_g5538hypothetical protein

Sequence
7152 bases(100 bases per row)
TGCATCAGATTGTCGATCATGAGCAGCTCGCACAATGGGAAGATGCACTCGCTGGTTATGAGCAAGCAATCCAAGAAATCCAGTCTGTGTTATCGTCCAG
ATCATTGCCCCTTGGTACTCCTTACTACAGCCAGCTTGCGATAATGGAGCCCCAAGCAGAGATTTTGGATGTGGACGCTCACAAAGACCCAGATATGATA
AAGCCTAAGCTGTATTCTGGAATGATTGGCTGCCTTATCCAACTCGGACGACTTGAAAGCGCTTTGCAGCATATCAACGGCATTTTAACGCTGGAACCAC
AGTTCATGGCTACGTTATATCCCTATGCGCTAGAATGCTCTTGGCGACTCTCGCGATGGGATTTGCTCACAGAACTGCTGAGCACCGAAAAGAAGACCTC
GGCACTTCactcttcgtccagctcttcagATGGGTCAGCTAACGCTCGACTAAAGGGGTTTGACGTCTCGCAGCTGATGTTGGTTCGTGTGCTGCATAGT
TTGCATGGtggtcaacaagaagaattTCAGCGCCACCTAGAAGCAGCTCGCCTAGAAATAATGGGGCCCCTCgcagcggcgtctgcagAGTCCTATCAAC
GTGCGTATCCGTTGCTGCATGATCTTCACTTTCTGCACGAGGCTGAGCAAGGATTCATATTTTTGCAGAAAGTAAAGGAGTGTGAAGACCCCGATCGACG
CAGTCTTCTCTGGAAGAAGCAAACTCCTTGGAATGTGCGTTATGATGCGATGGCGACGTCGTTAAAATATCGTGATCCGATACTCGCACTTCGTCGAGTG
ATTTTGCATGAGGCAGGGCTTCGAAGCGAAGTATCTTCTAACTGGCTGATGTACGCGAAGTTAGCAAGAAAGGAAGGGTTTCTACGCACAGCAACTAGTG
CGGTGATGCATGCTGGTGCTTTGGACAACCAGTACGCGCTGATAGAAAAGGCCAAGGTGCTCGTGAGACAGGACCGCATGTATGAGGCCTTGCAAGTTCT
TGAACCGGTTGATATCGATGCATCCACACTGGACTTTGACGTTGATGACCCTCACTTCTGTGCCAAAAACTTGCTTTTGGCGACAAACTGGATGCAGGAG
TCGGGCCAGCGTCAAGGTAAAAAAGTGATCGAGCGATATAAAGCTGTCATTCACTTTGATCCGACGTGGGAGAAGGGATATTTTTTCCTGGCCAAATACT
ACGAGTACTTGCTGAGTGTGAGTCACCCTGACGCTCTAAGTGGGTCAATGGGCAGCGATGAAGCGGATGCACTTCTGCTTGACTCGGTGTTTCACAACCA
CTTGATCAACTTGATGAAGAATTATGTGCTAGCACTGGCACATGGAACAAAGTTTGTGTTCCAGTCACTTCCACGTCTGTTGACGCTGTGGTTCGAGTTC
GGCGAGGTACTATACACAGGGCGAGCAAGCAACAAGGCAAACAAAACTCTGCGGGCGATTGAGATCGGGCTTAGCCAGTCCACAACTGAGCAGGGTCTTC
TCGACGACATCACGGAAGTAGTGAATGAAGCTGCTAAATCGTTGCCAGCGTACGAGTGGCTCGTGTGTTTTCCACAAGTGACATCTCGCATTTGCCACCC
GAATCCAGTTGTAGTTGATGGCGTCAAGAAAATCATGATTCGAGTACTTCTGGCTTATCCAACGCAGGCAATGTGGGCGCTGATCGGTCTGTCGCGATCG
TTAAATGCCCAACGAAGAAATCGTGCGCGAGAGATCATCTCGAACACACAGCAAGAGTTGCAGTCGCAGGGTCTGAAAGAGATTGCAGACAGTCTCTCTG
AGGGGATGCGAATGGCTGAAGAGCTTATTCAACTTGCTGCCCATGACCCCGGCAATGGTCAACGCAAGATCCACATCCGACTGAGCCGGATCCGGACGAG
GATTCTCGTGCCAATCCAAGCGGCCCTGACGACGATCCTGCCAACATCTGGGCTCGCCCCTGCCGATAAAAACCATGTTGCCTTCTCGTCAAACGCGCAG
GTTTACATTAAGGCGTTCAGTGATAAAGCGGATGTGATGATGACCAAGGAGAAGCCCAAACGAATCGAAGTTTTGGGCACTGATGGAGTACTGTATCCCT
TCTTGTGCAAGCGTGAGAAGACTGGTGATCTTCGCAAGGATGCGCGTATGATGGAATTCAACTCGATGATCAACAAGCTCCTTCAAAAAGATCGTGAAGG
CCGCAAGCGCAAACTCCGACTGCGTACATACGCCGTGGTGTGCCTAAACGAAGAGAGCGGACTGATGGAATGGGTACGGCATACGAAAACCATGCGGCAG
CTCATCGGTCAAATTCACAAGACCGAACGTGGCTACATCCAGCCTGTACGGTTGACACATGAAATCAAGGATGTGTATTTGGGCATGCAGAAAAAGTATG
CAAATGACCCGCCAGCAATGGCCCGACACTATCGTCGGGACGTGTTAACACAGCCTGCTTTCACACCACGGTTCCACCAGTGGTTTTACAACAACTTTGC
GGACCCGACGGCATGGTTCGAGGCTCGACTCATGTTCTCCCGGTCGGCCGCTGTATGGTCTATGGTGGGGCACATCATCGGGCTCGGTGATCGCCACGGA
GAAAACATTTTAATCGACTGCACCAACGGCGAGTGTGTGCACGTCGACTTCGACTGTCTTTTCGACAAGGGTCTCAAGCTAGCGAAGCCCGAAATCGTGC
CGTTCCGTTTGACACCGAACATCATCGACGCATTCGGGATCACGGGATACGAGGGTGTTTTCCGTCGTGTAAGTGAGGTGACGATGCACTTGCTGCGAGA
GAACAAAGCGACACTGCGAAGCGTGCTGGAATCCTTCATCCATGACCCCTTGGTCGAGTGGGGTCGGCGTGGCAAAGCTTCACAAAGCAGCGGTGGATCA
AGTAAAACCATTTCTGAAATCTCCACGGAGCGCAGCAAACGGGAGACGCGACTTGTTCTTAAAACTATCGACGACCGACTACGTGGAATCTACAATCTGG
GTGATGCCATTCGTCCACTTGTGTCGACTTCGCATCGTAACATATTGCCGGAGAACGAGACTTTGCCACTTTCAGTACAAGGCCAAGTCGACAAGCTCAT
CCATGAGGCCACGTCACATGAAAACCTCGCCCAAATGTACATCGGGTGGATGCCGTTCCTGTAGCGACTTCAACATACATAGCATTTTTTTTCAAAAGCA
TTTGCAAATCATTTCGCTATTTCCGAGATTGGCCACAGGTGATGGAGGTGATCGCAGTCGGCACGGCCGCCATCGACGTGGTCCACGAAGTAGCCGCGTA
TCCGGGAGGTCCGACTATGACTTACGTCGAaaatgtacatgtactgaCGATTTCTTGTGAACTAGAGGATACCAAGGCGCGATCATTAGCGACGTATAAG
TGTCGAGGAGGAAACGCAGCGAACGCACTGGTAAGTCACCAGTAGATATTACATCAAGTATTACTGTACAATACTACAAAACAAAACAGAAAAGCTAATT
TTTTTTATTCTGTCGGATAGGCGGTTTGTTCCCAACTTGgtggtcgctgcagatgGTTGAGTACGTCCACGGATCCGGCAAACGACAATGACGCTGCATT
TATCCATGCAGATCTGGCTGCGTTCAATGTGGACTGTTCATTGGCAGTCATCGAGACGGAAGGCAGCATGCCACTGTCGGTAAGTTCTAGTTAACGCTGC
AAAAGTTTCAATGCTTGATGCTAATGGAAGATCTGTACTTAGTACATTCTTGCAAGTCGAGCAACAGGGTCCCGGACGATCGTGCACTCTCGCACGATTG
CGGAACTGACCTGTGAAGCATTTGCAACGCAATTTCAACTATACCTGAAGGAGATTAAACAAGATGTAAGTGCACCTGTGTGGTTTCACTTCGAAGGGCG
CAACATGGAGATTGTGCGCGAGATGATGCTTTACGTACGAGAAAATGCACCCCAGGCGAAGATCTCGGTTGAGATCGAGTTTCCGCGATACCCGTGGAAT
CTTGCCAAAACGTACGAGCAATATTTAAAATGTTTGGGGGGCTCTGTTGTGGTCTAACTTGGCCCACCGATTGGCCACGTGGAAATATTTGTAGATTGGC
ATCGCTCGCAAACTACGTGTTCATGTCTAAGGACTACTTGCGCGACAACATTGCCATCTCCAGCGCAGAAGCGTTTTTCGAAGGGATTCGCGCGGGTCAA
TGGGGCGATGACTGGAAGCAATGGGTGGAGGCATTTATCTGTCCTTGGGGGTCGGAAGGCGTGTATTATCTCGAGATGGCTGGGTTAACGGCGCATCATA
TTCTCGCCGCTCGTCTTGAACGTGTCGTGGAATCGAATGGGGCGGGTGATTCGTTTATTGGGGCAGCTCTTGCCGGGTTATCTCGTGGCGATTGTCCACT
TCACTTCGTTTTGAAGACGGCGTGTGATGTAGCAACTGTCAAATGCTCGCAGCAGGGGTTCAAGCTCCCTACGGACAAAGTGTTGAAGTGGAAACAGGGT
CTGCAAACAGGAAATTCGGACGACACAAATGATGCCTGATATGTTTTATCCTGCTTGGAGTTGAGTTAGCTGAGTATGTCAAAAAGAGTGCAATGTTAAC
AACCGATTGTGCTGATGTCGAATACTTTACCTAGAAGAATATTCTAAGGAATCTGAGGCAACACAATTTGACGCAAATCaaggcagcaacacgaaggcCA
AGTTAAACAGCGCTGAACAGGTAGCGCATTGTGTGACGTCTGAGGTTGAACTGGAGTTGGAACGGGTAAAGTATCCTGCCCAGACTGATAACGATCCAGC
ACACCTGTATGCTGTGCCATTTCTTTCGACACTCgaggaaggtgaagatgaagacattATCATACCACGGAGGCGTGCGATAAAATGAAGGAAGTCAACT
AAGCCACAGGTGGATATCGTGGATGATACTTCTGGCAAAGCGAGTACTCCCTGTGCTACTAGCCAGCAAACCGCATTCGTCTTGGAGGCACGCCGTCAAA
CAACATGGGACTCTGCTGGCACGCAACTTTGGCGAGAAGCGTTCTTCCTCGCGGGATATATCTATGGCACGCCGGTCGGATCGATCTTGATGGAATGGTT
GCGTGAGGAGGCTTGACTTTTGTGCTTCATATTTGTTGTATAGGAACGTTTTGCTGGCCGAACTGTTCTCGAGCTTGGCTGTGGAATTGGTACCGTGCAA
ATTCGAGTGTACAAGAGCAGTTTGGGAGCTCATTCTGTTTTCGTGGTCCAATCTAGGTTTCACATCAATCGTGGCCTCCCGGGTGAGTCGGTGTGTGTAC
GTGGCCGACTCGGATGAAAACGCATTGCTTCTAGCTGCAAAAAATTCTAGACACAGCAACCATGTACGTCATTTATCCTGTATAACCAGGCTTAATGCAT
CTTGAAGTTAGTATCGTGGTGGTGTGCAGGGAGATTTGAGGCTCCGTTTGCTGGACTGGAGCGATAACAACTTGATAGCAGTACCAACCGGCGATACGTC
GGCTTAATTCAGCTGGTCACCTAGTGACCAAGCAGAACTAGAAGATCTGACAATCATCATGGCAAGGTATGATTGCATCTATGGCGAGGTGATCTGGAAG
CGTAGGTGATCGTAGAGACGTAGAAGAAAAGAgattgttgttgtagacgtCAACAGACGAAGTAAGTTCATTTAGagttcaagtcgctgtcTTGGAGACA
ACACCACCTATTAAAGAGAAGTGGTGTTCACTATAACAATAGTGAAAACTGTAGTGATGTGGCCTGTCACTTGGCCAGGAACACGAACAGGAGCAGCGGA
AGGTGGCCGTTGAGGTCATTGATCTGACGACGGAGTGAGGTGGCAGACACGAGCAAATTCGGTGACGAGGAGAGTGGCGCGGATGAGATCTACGGTGGCG
CGAGGCAGGCAGGAGGCtggaagcaccagcagcgagaggtATGTCGAGTCGACATTGAATATCAAGAATGCAGGACGGTCGCCAGGCTGGCGACAGGAGC
GCGAATCACTGGAAGTAAGTGTTAAGAAGCGAAATTAGCGTCCAGGAGGCCACAAAGAGCAGCGAGGACAAGGATGAAAGTGGGAGCTGGTAGGGTAGGA
ATAGGCCCTCTTAGAAGGTAGGTAGGCGACGGTGGTGGGCTTCGTAGGAGGGCAACAGGCGTGCGGCTGGCCGTCTGACCCTCAGTTCAAGATTGTCTtc
ggcggaggaggacaGTAAGAGCTAAATAAAGGAGAGTGGCGCCGACACACGGGTTACAGTAAAGCGAAGGTGAGGCTAGGAAAAAGTGAGTGAGCTAAAC
GTGTACTGCAAGAGCGGATTAAAGCTAAGCAGGGTAAAGCGGGGACCATGGCTTACGACCATGGGGGCTATGACTCGCCTACTGATGGTGCCTTGGCCGT
GAAGGACAACGGAGGACCCAAGCGCTGGAGTGCTAGCGTAACGGGCTTCCTGCGTCCACGAACTGCATGTAAATACGGGTTACTTTGCGAGACACAGCCC
ACAAACCCTTCCCCGGGGTGCCGGTCGCCGATAATCGTGTCTACCCCGCTATCCCTGTCCGTAGAATGACTGGTTCAACGGCCAGTAGCTGTCTGGTAAT
GCTTATCCGTACTGCCTCGGCGCGGGGCTCCTACTACGCCTACCTGCTGCCTAGGTGTGGAAGCGAAACAATCCGGTGGTGTGGTGGCTTCGTGAGACGA
GGCCAGCCATAACTACAAAACCATATTTAACAGTTCGGAGAGGACCTATCAGATCCTGTTATCAACTCTTAGAGAGTCCGATCTCTGTGTAATCAGCATG
TTTAGAGTTCAACAGCCTCCCTGCCTCTTACCATATTATATCAGATCCTGGATTTATATAATCTTAGAGGTCACTGATTCTACATGTTGACGACTTCTCA
GTCTTCAAAACGCCGGACCGAGGAAACCTCTTGAAGCTGGCTGATCCAACTTCACCCCACAGTTTTACTGCTGGGGAAGAAGGACGTTTAGGAGGCACGC
CACGGTTGGGAATTTGAGGACAGAGAGCAAGACACCGGCAACGGCACTCATGCAGCACAGGCctcgcaagaagaagaagaggaacaaCGCGACCGCAAAG
AGGCTACACGCCcggaagaaggccaaggcgaGCCGCACGCGCTCTTGGCGTG