Description :
From Genome Similarity Track
Location :
Scaffold_327:15768- 19163
Sequence
3395 bases(100 bases per row)
TTATACGAAGATTAATCCACCAGCGGTTCGGTGGTTCCAACGGCGATTCCTCTTCACGATATTTGGTTGCTTCACAGGCGAGAGTTTGCCACTCATTGTA
CCTTCGCGATCCCACCGACACGTATACTGGCGATCTGGGTATCATATCAGTATTCATCCACCAGCCTAAAGAGGCTCCAGGATTTACAATCACCTTTCGA
TCCACGATATTGGTAAGCTGCAAAATTTTCTTCGGCCTAATTCTGTAGTTACTGTTGGTACCCAAATTCTTCCCGTCTAATCCATATCTTGGCCTTGGGC
GCAACCATATTGATCCGTACTTCGTCGATCCACCCACTAGGATTTTCACATGATGATCATAGTTCATTGTTATCGGTTGCATTATCGATCAATATGTAGG
TCTCCTCCCAGGTAAGAGTATTTTAACTTATCCAGTAGGCGAAAAAGTCCATCCACTAGATCCAAGCGTACTCCAGCAGAGACCATACAATTCACCCACA
ATATCGATTCCTGGCTAACTTGATCGCCTACCAAGGCATCGAACTAATATACCAGCGATCCGTTCGACGAGATCTTGATCTTGGTACGTCCCACATTCGT
GTATATATTCTCAATAGATCCCACAAATTGTTGCCTCTGACTCTCGTCGATGACGCAACCTACCTTACGAGTAAGAGTGGTATCGACAATTTGAGACTTT
AACTCCTGAGTCCAAAAGAAACGTAGTATTTTCGTTGTTGGTATTTCCATTGCCTTGGCCTGTTTTAACCATAATCCAGGGGTGTGAGACCCTCAACATC
CACGTGATACACCCGGGAATAAGTCAAGTGCCATCTCGGTGGGCGATATCACATACTTATCCGCCCGTTTAACACTTGATATGGAAATTATATAATCAGG
GCCAAATTATGTGTATTAGCAATCAGATTGATCTGACTGTCCGCATCTCGACCCTTCCAACTTCTTTCAACAAATGCATAAATGCAGAGCCTAAAACGCT
TGACTCGCGCCAGATTCCATCCTAGCGTCCTAGTTTAATATTCTCTCCACCTTGGGCGGAAACATTCCAGCATGCTTGGGGCACATACCACTTGCAGATG
AAATTGTAAAAAGCTACCATCGAGCATATGCCAAATGTGGTCCCATGCGTCCACATTTCTGGTAGGTCAATCTCTTCCAGAACCCTCAATCACCGTGTTT
GGTCAATCCACAATGGGTGCACGCTCTCCATTGTTCACCTCGTCGTGATCGTCCTCCCAACCGGCATCTCTCTGCCAAGTACGATGATCTTTGTCCGATT
TCACCTTATTGGATGTAGCTATCACACTAACTCTACGACATTTCACTTCCTCATCTAATCCACTTGATTCCAAATCTGATTCGCTACTTTCACTCTTTTT
ATTGGATCGCTCGTACCGCTCGAGCAGTCTTTAACGACCATCGGATTCGGAGACACGACTATCCGCTGATGAAACTTGCCTGATTCCATCGACGCTTTCA
TCTATAGAGTATGCATCCGCTGGTAAGCACGCGGAGTTCCCTCCATCTCATCTTCGTCCGGTACGCTCAGTAGAGTCAGTTGATTGGCCAGATTGCAATC
GTCTAATGTCGCAATGAATTTTTTTTCCGTATGGTTCCGACGTGTAGCTGATGTAGCCGAATTTCCTTCAAGTTGCGCGATATTGGTCTGTATAGCTGCA
GCGTTAAGGCGGTATAGATACTTCAAAGGAGTCTCGTCCGATCGCATCCCTGTGTGGTAATATGCTCTGGCCACTGACACACCCATGTCCGCTGACTGTA
CCAGTAAACATTCCAGCAACGGCTTCCATTTACGCCGGGTAGATAGTGTCAGCTGACTTTACCGGTTCTGCACCGGTGGTGTTAGCAGATCGCCAAACAC
TATCCACTTTTCTTTAACGGTGTTTGATCGCTCAGAAATGCCGACTTGACTTTTCTGATACACCTTCGGGACCGATCTTCATATCTGTCTTTGCCGCTGA
ATTCCTTTTCAACAAGTACACGCTAGAGAATTGTATCACCATTCTACAACGTTTCGTGATGGCTACCAACGCACGACTACGATCCTCCTGCCTCGAATCG
TCAGGATTGCCATATTCAGGATCGTAAATTTCAGATCGACCGAGATGCAATCCGACCGATTCTATCTCGATATCTCTGATGTATGCTTCTCTAACTCTGA
ATCCTTGATGATGTTTTTTGTATAGATCGCTTGACGGGCTTGCTCTCGTTGTTCTTGTGGGAATCATTCCATAGTCATGTCGAAGCAGGAATTCTAATGT
CCTTGGCTAGGAATCGTCTTTTTGTTAGCGCGTACAGCTGTCGATCGCGGTTCGGTCTTGATTCGATCAGCTATATCTCTTAGATGTACTATCCCACTTG
GACCTAAGGACATGCGCTGAATGCCGATCGAGTCGTCCGGTTCAATCTCGAATTCAGCTGATGCATACTGTGACGATCTGGTGTGTTATCCTCTCAGAAT
GTCTGCTATCTCTGTGTCCACTTGGTCAGCGGAATAACATTCGCCTGTAGGGGAAATTTAATTTTGACAGAGCGATCGACTCACGTCGATCACCTTACTC
TTATCATACTCCAGCAAACTTTTTAGGTTGAATGGTCCTGCAAAAGACCCCGTACTCACTTAGCAGCTCGATAATTCTATTAGCCCCTATGTGTATTCAA
CGCTGCAGCTGGGGATGATACATTATCTTGGATCGTGCCGCTCAACTTGGGCTTCATGATGAGTAGCACTAAATCGCTCGCTATCAACTTCTTGAGCATC
TTTCAGTGAAGCTCCTTCGTCAACCCGTTTAGTTACCAATTGTCCATCTTCACATCATTCTCTACAAACTCTATCGGTCGAACGATCGATTTTGTAGCGC
GACCGTGTTCATGTGATCCTAGTGCTTCATTATTCTTCATTCGCCCTGTCTTCAGATCTTTTGTCTTTGAAGCTTTTGGAGTGGTCTTGGATGAATTCAT
TTCGGTTGTATCCGAGTGGTTTTCACCCATCGCATCATGCTTTGCAGCACGATACGCGGTGGTCTCCGGAGAGACCTCAGGAGAAGTCGAGGTTTTTCTT
ATCGAGGATCGATCGTCCTCTCTAATTTGCGTGTCATCAGAGCCCTTCATAAAACTCTAGTAATCCGGGGATCATATAAAATCACGCGTCTACGGTGATA
CTCGGCCTCTGGCGCTTCCATTCCAGGCTTCATATTTATCTTCTCATCTTCACTCCGGGACCCACGGTGAAATCCTGTGTCACCATCAGATCCAGGCCAG
CGCACCAGTGGGGAGCGGCGACCCCTCACTGTCTGATGCGATCCAAACCTTCTAGTGGCAATCAGATGACTGACTATGGGAGGGTGTATTATATT