Description :
From Genome Similarity Track
Location :
Scaffold_133:157662- 160344
Sequence
2682 bases(100 bases per row)
TTACCTCCCGATAGAGGTGTACGTAATGAAATTGACTTAGTTCCAGGAACTAAATAGTGCGTAACACGGCAGTAGCCTTTACCTAAGGAACAGTGTGACG
TCATTGACGATTTCTTTCGTGCTAAGCACGCGGCGGAAATGGTGCGGGAGAGTAAGTCTCCCCATCCCACATCTACATTTTCTGTAAAAAAGTCTAATGG
TAAGTGGCGTATTGTGCACGCTTATAATAAGCTCAATGCTGCCACTATCCCGGCTCAGACACCAATCCCCTGAAAGGGTGCTCTTCAGAACAATATGGTG
GGATGTACATTGTACAGTGCGCTCGACGTAGTTGATGGTTATTACCAGCTGCTCATGCGAGCAAGCGATATTCCGGTAAAAGCGGTTAGTACCTCGATTG
GTATGCTCTGGGAGTGGCTCGTTATGTCACAAGGGCTGTCAAATGCACCGGCTACTATTAATCGTCTGGTGACGCAACTATTCAGACCTCATCGAGGCTA
TGCACAAACGTACTTTGATGACATCTTTGTTCATAGTCGTGCAACGAACGGTCGATCTGATGTGGATAATCACATTGATCATTTACGAGCGGTGATCGAG
TGCATGCGCACGAATAAATTGTATGCAAATGCATCTAAGTGCATCTTTGGTGCAGGAGATTCCCTTTCTGGGGTGCTTCATTGGGAAGCGAGGCCTTCGA
GCGGATCCCGCTAAGGTAAGAGCCATAGTCGATTGGCCGGTTCCAAAGAACCAGAAAGATCTACGTAAGTGGCTTGGCCTTGCCAATTACTTGCGTAAGT
ATAGCGCGAATTACGCAGATATGGCTCGGCCATTATCCAATCTCATTAAGAAGGATGTGAATTGGTGTTGGGGTAACACCGAACAGGATGCTTTTCAAGC
AGTTAAAAAAAGTTTCCTTCATGCGCCAATATTGGCTTTGCCCGATCCTGATCGGCCTTTCAGTGTCGTCTGTGACGCATCTGACCTTGCCATAAGCAGT
GCTCTGTTACAAACAGATGTCGATGGACGCGAACGCGCCATTGCATTTGAATCTCGACAGCTCAAAGCTGCTGAAAAGAACTACACAGTTCATGACAAAG
AGCTACTTGCCATGAAGTACGCTCTAGTCAAATTTAGAGTATATCTGCTTGGCTCAAAGCCATTTGTGATCTATACAGATCATGCATCATTGCGCACTGC
GACACAGTCGCCGCATCTCTCTCAGAGAATGACTCGTTGGCTTTCATTCTTTGCCGAATATAACTTCGAAGTGAAGTGTAATCCAGGAAAGCAAAATGCT
TTGGCTGATGCTATCGCGCCGACCTGACTATGAGCTTGCTCACGTCACTACGCTTTCATCGTCAGTCAATGACTTATTCCGTGCGGCTTATGCCAAGGAT
GAACAATGTGTAGCTTTGCTACGTGCTCTTGGGAGCGAGTCGTTTAAAGACTCGGACATAGAATTGTCGGCACGTTTACGTGCGAGGCTACATCGATATT
CTATCGATAATGGCCTGTTGTGCTATCGCACAGATATCGAGGATAACCCTCGTATCGCTGTCCCTCATGATGATGAGTTGAAGTATCTAATCCTCTATGA
GGCACATGATACCGCTTTAAGTGGTCATCTCGGTCGTGAAAAGACCTATAGCTCAGTGAGCCAGGCTTATTGGTGGCCCAAACTATACAAGTGGGTGAGC
AACTATGTGCGTACGTGTGAAACGTGTCAACGGGTTAAACCCTCAGCACATGCAGCGGCGCCGCTGGATAGTCTGCCTGTACCCACTGGGTGTTGGGAGT
CCATGATTATGGACTTTGTGTTTGGCCTACCGAAAGATTCGGAAGGCAACACTGGTATTGTGGTATTTGTTGACCGATTGAGCAAGATGGCTCATCTAGC
GGCAGTACCGGACTCTGTTGATGCCGAAGGTACAGCGAAGATGTTTATCGACCGTGTGTTTCGACAACATGGCTTGCCAGTATCAGTTGTCTCTGATAGA
GATCCCCGCTTCACTGGGAAGTTTTGGAAGTCCATCTTCAAGGTGCTCGGCACCCGTTTGGACATGTCCACAGCGGATCATCCGCAGACCGATGGTCAAA
CTGAGCGTGTTAATCGCGTCATTAATGACATTTTGCGCAGTGTTTACGCTAATACGCCTAAGCGTTGGAATCCATGCTCCCTGTTGTTGAGTTTGCGTTG
AACAACGCTGTTCATGCCTCTACAGGCTATACTCCGTTCTACGTAAACGGTCTCACCCACCCTCGCGTTCCGTTAACGCTACCACTATGTGGTTCAGGGC
TTGGTGGGGGAGAGGTTGCCAATCGGCTTGCTGATGTCAGCCCTTCTACTGTTCAAAAACAGGTAGGCGAGTTTCTTGCAACGCGATTGAATGTCTTAAG
ACATGTGTGTGACGCAATGGCTGAAAGCCAAGGCCAACAATAACAACAAGCAGATGCTAAAAACAGAGGTTGTATCAAAAGTTATCATTTCGGAGACCAA
GTATTACTTAATGCTAAAAACCTTCCTTCAAATGTAGTGTCCGCTCTCTTCAAGACAAAGTTGCGTCCGAGCTTCATTAGACCATTCACGGTCGTTGCTA
AGAAGGGACTTGCATATACGCTCAACCTTCCACGCAAATTGCGCACTCATCCTGTGTTCTACGTGGGCTTGCTTAAGCCGTA