Description :
From Genome Similarity Track
Location :
Scaffold_4:1576504- 1588300
Transcript NameFunction/comments
Phyin_T30-4PITG_03389Replication factor C subunit 4
Phyin_T30-4PITG_03390WD domain-containing protein%2C putative
Phyin_T30-4PITG_03391Putative uncharacterized protein
Phyin_T30-4PITG_03392Ras-like GTP-binding protein YPT1
Phyin_T30-4PITG_03393Autophagy-related protein 8
Phyin_T30-4PITG_03394Putative uncharacterized protein
Phyin_T30-4PITG_03395Putative uncharacterized protein

Sequence
11796 bases(100 bases per row)
TTCGCGCGAACCATTGAGCACGAGATTTCGCCATGTTCAGCTCTACATCGACATCCAAAACCAACGTCCCGGCGCCCGTGCTGCCATGGGTGGAGAAATA
GTAAGTGTACTGCTTTTTGCCACATTTCCACCTAATTATGTAAGATTTATATTGGCAATATCTCGTGTTTGCTGCGCTTTAGTCGCCCCAAGAATGTGGA
CGAAATCTCCCACCAGGAACACGTCGTAGCTACGCTCAAAACATCGATCGCCAACGGCCAGTTACCCCACTTGCTCTTCTACGGACCTCCGGGCACGGGC
AAGACGTCCACCATCGTAGCTGTGGGTCGCCAGCTTTTTGGACCGGACTTCCGTAAGAACGGTCGCTTCCTGGAGCTGAACGCGTCAGATGACCGAGGCA
TCAAGGTGGTGCGTGAAAAGGTCAAGAGCTTCGCCCAGGGTGCAATCAGCAGCGCCAGCGGCCTGCCACCGTTCAAGATCATCGTGCTCGATGAGGCCGA
TTCTATGACCGGCGACGCACAGTCTGCTCTGCGTCGCATGATGGAGAATTACTCCAAGGTCACGCGCTTTTGCCTTATTTGTAACTACGTGAGTCGAATC
ATTGAGCCTGTGGCCTCGCGATGCGCCAAATTCCGTTTTGCCCCGTTGGAGAAGATCTCCATGGCGTCTCGTGTGCGCTTCATTGCCTCCGAAGAACGTG
TCGATGTATCTGATTCGGTGCTGGAGTCGCTGCTCGAGTGCTCGACCGGAGACTTGCGAAAGGCGATCAACTACTTGCAGAGTGCCAAGCAGCTGTGCGG
AGACGACGAGCTATCACAAGATGATGTCATAGCTGTGGCGGGTCTTGCTCCGCCCGAGCTCCTGCAGCAATTTTGGGTATCGGTGACTTCGAACAGCTTT
GAGAAGATGAAAACGGACATCGAGAGTATCCTGCTGGCTGGATACCCGGTGCTTACGATTTTGCGGCAGCTGAATGACGACGTACTCGCACTAGACAAGC
TTAACGATGTACAGAAGGCTCAAATCTGTCTGCGCATTGCTGGGGCCGATAAAAGACTGGTGGATGGCGCCAGTGAGCATTTTCAGCTGCTAGACGTTGC
ATCCTACGCCATGCGCGTTTACCATACGTCATAATAGATCGATCTGAGGAGTTCTCGGGTGACGATGACACGCATTAATAAAGCTGAACGACAATGAAAA
ATGGACACAGGCACATACTTAGTAGGAGCACCTAGTCTTTAGTAAAAGAATACCAACTCTAACTGCCCTAGCACTTGGTAGCTTTCGCTACTCAGACATC
TAATTGCTCGTGATTATAGTTGCGCCTTGATCATTTACTGAAGACATCTGCGTCCATTCATGATTGCTCTGCTGCTTCCAGAAGGTTACTTCGTCATCAC
CAGCAGCGACACTAAGCACAGAGCCCGTAAGTGACCAGCTCAAACGGTACACCGGCGCGCGGAACGTGTGCAGGACGTGGGACGCCCACTCGCCATCAGC
TTCATCTTGGGTCCACACACGCACTGTGTGATCATCCGACCCAGATGCAATCGCGTTCGCCGGTATACCCACATTTGGCGCCCATACCACATCGCGAACC
CAGTCGTTGTGTCCGTAAAAAGGAGTGATCACAACTTTCCAGTAGCTGTTGCCAGCATTGCTATCTTCCTGTGGCGCAGTAACAAACTGCCAAATAGTAA
CTGCGTGGTTACATGATCCAGTGACCACACGCTGGACGGGTCCTTGAGCTCCTTGCGAGCCCAACGAGTTGTAAGGCGCCCAGCTCACAGAAGTACAGCC
CATTCCCTCCTCCGAGTTGCGAAAACTCGACGACACCACCCACCCTTCCCGCGTACGGGTAAGGAATGAGACTTGTCCGTCAGCCGATGCACTCGCTAGA
CATAGTCCGTATTCGTACGGCGCCCAGGCCACACTAAGCACGGCCAGCGAGTGGAACTCATGCACGTGTTTGAGCCGCCATTCCGTCACATTGCTTACTC
CTCCAGTACCCTGTTGGACTAATTCTTCTCGGTAGATGTACACCTTACCATCCTGAGCTGCCAGAGCGAGCACTGCCCCAAACTTAGGGTGCGCCCAGGC
CACGCGGTGAATCGGGGCCGCCGAGTCGTCGGCCAGAGGAACCACGTGTTGCAATACGTGAAGCTGCTGCTCCTGCTGCGGCTCCAGTCCGTCCTTCACT
GCTGAATGGTCGTCGCTATCTCCACCTGCCACCATGGCTTTCGACACGTCGTACACACGGAAGGTCCGGTCGGACGAACAAGTGACCAAGCGCTTGCCGT
AGTAGTCAAGCTGGATGTCGTAGATCATATCGTTGTGCTCCGTGTCGATGCTCGCAGCGGGTGTTTGGCGCGACGTCATTTGCTTCTGAGGGTGTTGCGA
CTGAAGAGGGTGAAGCTGTCCGTGCGGCGCGGCGAACTGACCGCTCGCCGGCGAGCCCTGCATGCCGCCTGCGAACTCCAAATCTGATACTCGATTGGAC
TATTTCCGCAAAATAGTCTCACCCGCCGGACCAAATTCAAATGCACCTGCTACTTTTCGGTCCTTAGGGCAAGTTGAAAATTAAGCGATGTTTTCAGTAA
ATGGGCCGAGTGGGCCAACGTCGAGGAACGAGCGCCGCGTTAAGAGCGATCGACAGCAAGAAGAAGAGGAAGATACCAGAAGACGATGGGCCGAGAAGAA
ACGCGAGCAGTTTTTTCTCGAAAAGCATGCCCAGGCAAGCAGCACGAAGCAGGGTTTGGAGCGTCCTGGAGTGTGTAAAGGAAACTGCAACTTCGGCACT
CACTCTTTGTGGCTATCGTATATTCAAAATTTAGAGGAAGCGAAACAGCGAGCGGCACAGTCCGATATTTTCAAGGTACATTCATAATGAGTCCTCCTTT
CGCTTCAAGCTGCAAAACTCCGCTTGACTTTATTGTTTATATGCAGGGCTGTCGAATTGTGTTTAATGGGCGAACAGGCAAAGTATCCTCGTACGTGGAT
GTGCAGGTGATGAAAACTTGCCTGTTTGCTCTAACACCTAATTACTTTTGTTTCATAGATATTACTTAGCGAAGTTGGTTCGGGAACACGGCGGAAACGT
GGCGTACGCAGAATTAAACAACCTGCAATGCGTCATTTGACTTGACATTCCTTGTGTTGCGGCTGGTACCCATTGTAGCTCGGCGCTGACCGCCACGCGC
GTCACGCACATGGTCGGCTCCAACTTGAACGGGTCCAAAGCAGATAAAGTGCTAAAGGTAAACCTATAGTTCATCCTGATTGCGAAGAAGGAGAAGAAGC
TTATGATGAACATCTCGTTGCATGCAACAGAGCTGTGGCAAGGTTAAGTTCGTAAGGCCGGGTACGTCTACTACCGCGTAGTACTACTACATGTAGAAGA
TGGCTAGTGCTATGAATCTCACAAACGCTTGTACTGTAGAATGGATCCTTCAGTCTGTTAAGCAAAGAAAGCGTCAGCCTGAGTTCGAATTTGTCGTCTA
CAAGGATTCCAACGCTACAAGCTCGCTTAGTGCTGCATTTTCTCGAGGGGGAAATACTAGAACAACGGACTAATGTGCGCCAACTTCAAATGCAACTAAA
GCAACGAAGTACGTAGCATAACCCAACTTGTAGAAAAGAGAATGAATATACCGTGTATAGGGTCGCAACTAACCAGAGTAGCATTCGTTGTCGCTCCTTT
CAAGCCAAAAACGAGGACGCGAGACCTAGGAGAGAAGCGCAGACACGACTTGAGAAAGCGCCCTGATACTCCGTTCCACACGCCACCAAATCCTCGAACA
GCCTTTTTCACCCGCGCCACACACCTGATCTCTTCATCCTGTTCTGAACTCGCCCTGAGTGTCACGCCTCGCTACACACCCCAGGGCCAAACTGCAGATA
AATCAACTAATGCGCGACGCGAGGCTAACAGGACTAAACGACACTGCTTAGCAGCACTTCGACCCGCCATTGGACGGGACCTGCTGGCCAGGCGTCAGCT
TAACTCCGGCCTTGGGGGCCACGGGCGCGTTTGCCATGCGCTTCTTGATCTGGGCAGCCATCATCATGAATGCCTTCTCGACATTGGCGGCGTTCTTCGC
ACTGGTCTCCAGGAACTCGATGCCCAGGCTTTCGGCAAATTCCTTGGCGGCGTCGGTGCTCACCACGCGCTTGGCCGTTAGATCGCTCTTGTTACCAACC
AGCAGCTTGTTCACGTTCTCACAGGCGTATCTGCAAATCAAAGCGGTCCATCACTTAGCTCTTTCTTTTCTGTAGGTCCATTCCGTAAACAAGACGAGCG
CACCTATCGATCTCGTGCAGCCACTGTTTCACGTTATTGAACGACTCCTGGTCCGTCACATCGTACACCACGATAATACCGTGGGCACCGCGGTAGTAAC
TGCTAGTGATCGTGCGGAAACGCTCCTGGCCGGCAGTGTCCCACTGTTGAAATAGGAGAACCGTTAGTTAAATAGGAAATCACGCGGGGACAAATGTTTT
TTTAGCGGCGTACAATTTGGAGCTTGATGGTCTTGCCGTCCAGCTCGATCGTACGGATTTTCTAAGCAAAATCGCGAAAGCCATGTGAGCAATGTAATGG
CAATCTAGACCTTACAAAAGGTCGTTTGGCGTAAAATATGTTAGACACTCACAAAGTCAACACCGATGGTCGAGATGTAGCTCTCCGTGTACGTGTCGTC
AGCGAAACGGAGAAGCAGACACGACTTGCCGACACCAGAGTCACCGATCAGTAGCAGCTTGAAGAGGTAGTCACTGCATGTAAGAGACGCAGGTCAGCCG
GATCGAGCCTTCTAAAAGCAGCAATAAATCAGCTAGTAGCATGCGATCCTGCACGTACTATTCGGGGTTCATCTTGGTGGAATGTAGAGAAAAAGCGGCG
AGTAAAGGCGCTCAATCTGCAGCACGACACAGCGATCCCGTTAGTTGACAGCTTCCAGCATACCATGACGCTCCCTTCTTCTCCCCGTTCCGTCGCTCCT
AGATTCCAAAGAAAAACCAAGGATCCATTCACTTCTACCATACAGTGTAGATAAGGGAGGGCGACCGGCGAGAAGAGGGGAGATGAAGGGAGAGACAGCT
GCGCCCCATATTGGCGCTACAAGAATAGAAAGGCACCTACACCGAGAAGAAAAACGAGGCGACTCGCGCGTTCTGAGCGTCTTGGGTTGTGCTGCAAGAG
AGAAAGAAGGAGCCGTCGTTTTGGCCCGAGGTTTTTTAATGGTTGAGATCAAGGTTTTTCGGGTAAATTAACCAATCGATTCTCCCAGCGTGGCGCGAGA
AAACTGTGTTCAACACGCAAGTCGAACCACATCAGACTGATGCCTGCAGTTGGTGTTGCCGATGGCCGCTGTTCCTGGTAGGAACATCCTACGGACAGCA
CACATGGTCTACTGTACTACATATGCAATACTGCCCGACAGCGAGTGAATCTTTCGATGTGTCGAGCCTGGGGATTGACGTCGGTTCTGTAAAATCGCAG
TGTATTCGAGGTGGCAGGGGGAGAAACGAAGCCTGTTAAATATGTACGACGTGTGCAGTTGGGCTTGCAACTCAATTCGAGAGCACAATGGTAACCGCGG
TAGAACAGCATGCGATAACTAAACCGAAACGCCGTCGACGAGAGCTTTCGCGTCCGTCGCGCTTGCATTTCCAACGCCATCGCCTTCAGTAAATTGCTGA
TCCGTGGTACCAGTAACGCCCAAACCAAATGGGGCAACCCTAGCTGCATGCAAACGAAGAAAAGAATGCTGGCGTAGAGGCCTGCCAGAAAATGCTTATT
ATTAATACCTGTCTGCGTAGACCAATATTAACAAGAACAAGAAATGTTGCTACGAGGATCACGTCGCAGAGCTGATACATTCTTCAACCAGAGTGATGGT
CGCTCGTCCTCGTTTTATGAATCACAGCAGCGAATTACGTACTCTTCTCGAAAACTTTACCCTTACAAACTCTAGCATATTCTGTTCACCCAGGTAGCAA
AGCCCGAGCTATGTGCTAAAATGCGTTGAATTAGTTTTCTATACCTAGGGCTAGGTGTATTTGGATTGTTCCGACTTGGTCTCCCTTCACACAGAAAGGG
GAAGCCGAGAAGAAACGTCGAAGGCAAGTAACCCGATCGAAGCCAATGGTGGTGGCGCTCGAGCTCGCTACGCTGAGCCGCCTAGGCCCCGCTACACATC
TTTACGTGTGTGTTTTAGTGGTTGACGTGCAGCAGAAACCCGCGTCTCTCGATTCGATCTACGGAACGAGAACGCGCGAGTGAAGCTGGATCATCCCACT
CGGGAGTCAGGCGGTGGCTTCCAGTGTCTAATGGGGTCGCAGCACCAATTTGGCGCTCAAATAGTGTGCAGCGACCCTTCGTGGTGGGAAAGTGACTAAC
TGTGTTCTGCTATTGACCTGGCGCAGACGAACTGAACTCGGAATCTAGTTACCAAGAAAGGAAGCAGCACACCATGAGCTCATTTAAGAAGGAACACCCG
TTCGGTAAGTGGCCGTTTATGTCTCCAGTTTGCTGTGGCAATCGCTGAAGGCAATTTTTGGTGTCAATTTTGTAGAGAAGCGCCAAGCCGAGGCTCAGCG
TATCAGATCCAAGTACCCCGACCGAATTCCGGTATGTAGCGTTGACAAAAATAATTGGTTAATGTGTTAGCTGACGGATTAATTTACTCCTGGCGCAGGT
GATTTGTGAGAAAGCAGACCGAAGCGATATCCCGGACATTGACAAGAAGAAATACCTGGTGCCAGCCGACCTAACAGTTGGCCAGTTCGTGTACGTGATC
AGAAAGCGCATCAAACTGAGCCCCGAAAAGGCAATCTTCATCTTCATCAACAACGTCCTCCCACCTACCGGTACGCCTTCTCCGCTTCATCATTTTTTAG
TGAATACCATTTGTTTACTCACATCGCTGCGCTATTTTTCTCGTTCAGCTGCTTTGATGTCGAACATTTACGAAGAACAGAAAGATGTGGACGGTTTTCT
CTACATCACTTACAGCGGCGAGAACACGTTCGGTCAATAGGTTGCACGTGCTGTGCTCGTGTGGGGACTGGATTTTGGTTGAACGAGATTTTTTCGTCGT
CGCTTTAGGGAATTGCGAGGTTCGAGCTTTCTTGTTGCAGTAGCGGCGCTGTACTGTTGACTTCAGTAGGAACTGATGGCAAGATGAAGCCGCCGGAATC
TACTTCAAGCATGGAAAGAAGTACTACTACATGTAGTATTTGCTGCGGTGTGGCTATTTCTACTAGAGCTGGCGATGTGGATCTTTCTTAGGAGCAAAAA
AAACAGAAAAATGCATTCAATTCTATTCTCTCTGTTGTGCTTCTCTCTTACTCGCGCTGGAAGTGCAAAATTTGCAGACCTTGGCCGACGACAACAACTT
CGTCACTTCCAGTCGAGGTTTGTCGAATTGCGAGATCGGCAATATCGGCGCATTCAGAGAAGGCAGCTCCTTGCCACTCCAGCTCGGTGTCGTTCTCGTT
GCGACAAATGCTCCACTTGCTCACTCGTTGGTCGTATCCAGCGGCAAAAATGAACTCGGCATCAACACATGCAACGGCTTTGATAGCTGAGCCACTAGCG
TTAATTGTCCCAGCTTCAGAAAGCATTCGACACTCTGGGAATTGCAGCTCACGCAGGTTCAAATTCTGGTCATCTCCACCGCTGATAAGAGTCACGTCAA
GGCTTTCTTCCGTCTTGCTCTTGTTGCAGGAGACAAGATTGATGCAGTTCACACCCATATCGTGCGCCAAGTAGTTGCCACTAGGTTGCAGCTCACCAAT
CAGCTTCTGAAGTTTCGTCTTGAACTGGGCCAACTCTTCATTGGACTGAAGAAGTAAAGTAATCTTCTTGAGTACATCGCTCAAGTCCCATAGCGTCACT
AAACCATCCGTAGAGCCAACTGCTAGACCAGCAAGCACTGCGTCATCAGCACCTTTCTGAAAGCCAGCGCAGGACAAAATTGGCTTTCTTGAGGCCGAGT
GGAAGTCACCAATCTCGAAGAGTTTGCCACGGCATATATCCAGCAGCAATAGCTGAGTGGACCCTTCGGAATTACAAGCCGTCACTAGTCGATACGAGTT
CGAAGCATCAGGTACCGCAAACGTAGCGAGCCCGAGAATGCGGTGGTCCTGCGCTGCCTCAGCACGTTCGTGGCCACAAACATGACGGAGCAAGTCGCTT
TGTCCGCGAACTAGCCACACATTTAGACGTTGTTTACCGCCTCCGGACAGAAGGATGTGTTCCTCAATACCATCAGTATTTGTGTGTTGGAACGAAGTAA
GCGCCCGGACCGTAGTCGTATGGGCGATTCCTGTAGCCACACTTCCCCAACGCGAGTTTGTTCTACCGTGATCGCGTTGGCGATGAAGCATGAGGCTGTT
ATCTTCTGCAGCAGTAACCAAACGCTCACTTCCGAGGAAAGCCACACAAGTCGTCATGCGTCCGTGATGATGATCATGTAGTGAGCATTTGGAGAAACGC
GGCAAAGTCTCGGCACCATCGATTCCACTTAGAAGAGTAGAGTGCACCTTGACATCAACTTGCTGCTTTTGAATCGCTGGTGGCGTGAACACAAATGTGT
GTGAGGGCAAGGCGGAGTCGAACTCACTCGGTCTCGTGAAAAGGGCGTGTGGTCGGCGCCAACCACCACACTCCACGTTAAAGATACGATACTGCGCCGA
GAAGTTGTGCAGAACTGCTTGTGCCGCGTAGAATCCAAAAACCATAAGGTCGTGCTTTGTTTTACCGTGGGCAGATGACGCTTTGCTCCACCAAAGCTGC
TTGACTGTGGAAATGCCTCGAATAGACTCACGACCCACCTGTGTAGTTGTAAGCGCTCCAATTGCATCTGCTTCCAGTACGTATCGGCAAATGTATCCGT
CGTGTCCCCCCGACAACATAGAAGTCTCATTATTCTGAGCGTCTTCACTTTCTTCGGATAGAAGAAGAGAAGCAACTAATTCACGCCCGTGAACTCCTTT
CAGCACGACAGCAGGGGCCTGCATCGTCTTGAGCTTATCATCGCTTTCCGTTAAAATGAGTGAGCGGTTGAATACATACACACCACCGTGTCCATCGCCT
GCGATGACATTTCTGGTTGTCAAGCGATCAACGACCAAAATCGAAGATGTTGAGCTCTTGGCTGGGATCTTGAATGATGCCACAAGCTCCATTGTGATCA
CGCGTGAAGCCAAGCTCTTGTTGGTCTGTACTTTGGCTGGTTTCCATTCAGAGAGAACTGCATTAGCACTGCTGATAAATAGAGCGTCCTCCAGGTCCCA
CCAAATCTTCATAACTCGTACGTTGGGCTGGGTAATCCATGAGTACAGCAAAATACCAGTGGCTACCTCGACGATACACACGCGGCCCGTTATTTCACCG
AGCAGCAAGAAGCGTCCGGACGAATCCGTTGTGAAGGTCGACAAGCCACCGGTTCGTGCCTGAACGATGCCTTCGTTAATTGGGGGAATAGTAAAAAAGT
GTTCTGCTGTGAGCGACAAAAGGTCCAGACGGAAGATATCACCGTGCTCGGAGGCTACGAACGCTGTCTTGGCGTTATCCTGGATACTCAGTACGATGTT
TCGTACACTGCGCGACGATGGAGCTCCTTTCTTCTTCTTCGATGAGGACACTACTGTCGCAATAGGGACACGAACAGTCTTACACAAGTCGGTGGCTCCT
GGCCCATCAGATAAAGACATACGCTGGTGTGCGATGTCCCAGAGCTTTACAGCGCCATCACTACCTCCCGAGGCAATCATGGTTAGCGAAGGATGGACAG
CTGCACGCCATACATGCTTGCCCATGTGACCTTGTAGTGTGGCGATGCAATTGCCGTGGAGATCCCAGAGCTTGCAAAGGCCATCTTCACTCGCTGTTAC
CACGCCGTGCTCCCAGAAAGACACGTCCCAAACGCGCGCTGAGTGACCCCAGGCACGAAACACTGGAGAATACTCGTTCGCAAGAAGCTCAGCACGGGTT
AGCGTTCGTGGTAAATGGAGCTGTTCAGCTGTGATTATCCCATTGTGCGACCACAATTGAACCGTTCGGTCATCGGATACGGAGGCCAATGAGCGTGCGT
CCGAAGACCACGCCAATTTGAAGAGCACGCCATCATGCGCATGTAGCCGTTGGGCCGGCTCTACGGCAGTGTTCAACGCATTCTTTCCATTCTCCATGGG
ATTCCACAGCAAAATTTGCTGGAAAACCGTCCCAGAAGCAACCACAAGCTCATCCAGTGATCGTCCGTGGAACGCCAAAGCGTACAAAATGCAGCGCTCA
GCACACTGCACGCTGCGGAGAATATCGTTGCGCAGTGGATCCCATATCTGCACCAAATTGTGAGCCAGTCCAACTGCAGCCAGTAGATTCTCGTTCTTCG
TTAACGCAAAGTCCGTTGTCAGCAGCTGCACGTCGAACACCCAATCGCAAAACACTTTCGGTTTGGCCAGCACAGCAAGCTCCTCAAGTTCACAAGCGGC
CTCACAAGTCTGCGGCAGATTCTGGAAACATGACACGCGTTTTTGACCAAAGAAGGCGCCGACAAACGATTTATCTAAAGCCGAAAGTCTGACGATGTCA
CAACCGTGCAGAACGCCTCGCGTCAACACCTCGTGCTTCCCCAGAAGCTGGCCAGTCCCAGTAGCGTACAGGAATACCGTCGGACCTACGCCAACGTATA
ATAGAGATCCATCATATGAGAAAGAAACGAGTGTCACGGCACTCAGGAACTCCTCCTTCTTGATCGGAGGGTGCACCATGGCGACGTGATGGTGCGCAGC
CATCCATGATTGGTGACCGACCGGTTTAAAACCGGTATTCTCTTGAAGTCGCTTGGCACATGGCTACAAATGTTTTAAGCTTCAGAAATGATCCAGTAGT
TAAGGATTAATAAGTTAGTTTGTGTTTTATTTGCTATAGCTGCACGACCAACTCTCCAGTAACTTAGGGGCAATCTGGCAACTCATTAAGATTCCCGGCA
CTTCTGTTGCTGCCGGTACTCGCTGAGTTTGGAGAACACGGGCTTTTCCATCTGTAAGACTTTCCACACTGAGCGAGCCTTACGAAACTCGATTTGACTT
TTGCTCGGGTCGGAAACAGGCGAAAAATTCTTGGGCTGCAACGACTGCTCGAGAGTCTGCAAGCTCAGGTTGGCAGGAAGCGTTGCACCTCGAAGAAAGA
AGTCGCGAATTATCGGGAAGATGGTTTTAGCACAGGAAATACACTTTGGCACCGCGGAAAAGGTATGCGATGCCAGTATCAGCACTAGCTGATGAAGTTC
AGCACGACGCTGGTTGATCACATTGGTCGACCGTGAGCACAGAAGATGGCGCCTCGGTAGCCAGTAGTTGCGCAACGTTTGAGCGAACCATGCACAGCCA
AAGCATTGCGAACGAGCACCGCCTCCACGATGCAAGAAGAACGCGTGAAGAATCTTCAGCAGCTCCCGGAACTCCGAGTATCGGCGCTCTACAAACCACT
CAAGATCCGTCTCGGCGAGCGAGCACTGCAGCACAAATTGCGTGGGCTCGCCCATACGCGTGCTAGGCTTCACATTCACGAGCTTCACCACAAGTTTTGG
CTCGAGGCTGTCGGATCGGCACGCGATACTTGAGTGGAAGCATTCATTGTCGAGGTGCATGACTGCGATACTGCCTTTAGGACTGCGCGCTAGACCAAGC
AGATTGCGAAGTAAATAACTGCAATATGTCTGCTTTGCCATCGTTGCTAATTGCAGCGCAAGACACCATCATGAACACCACCTTCACTTTCTGATC