Description :
From Genome Similarity Track
Location :
Scaffold_298:15765- 17175
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_298-fgenesh-gene-0.4Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_298-fgenesh-gene-0.8N-terminal acetyltransferase complex ARD1 subunit

Sequence
1410 bases(100 bases per row)
CGTCCACACTGCTGCAGTGCCGCCGTGGATGGTGCAGAGCGAGGAGGAGTACAAGCGCTGCAACCAACGCCAGCTGCCGCTGAATGGGTCCACTGGTCTC
AGTGTCCAGGATATGTGGATGCCACAGCCGACCCATCGCGATCTGAATGGTCCAACTGAGACGAGCGCGTCCACCGGCGATCAAGGTGCAATCGAGAGAA
AGGACGACACTCCGTCACAGGCATCGGCAGTGAGCGACACGAATTGGCTGCCGAACTTTGGTGGCGTGTGGCAGGAAGGCCCGCGCTCCAAGACCAAGCA
CGAGTTTACCAAGACGATGCTGCCGCGTGCGACAGCGCTGCAGTTCCGCCCTGCGAGCGTGTATCAGCGCAGGCGGCAGGTCACACCTTTACAACCAGCA
CCTTCAGCACCATCCGTATCAATACAACCCACGCCAGGTTCAGGCGTAGCAGCAACTCCTGAGGCAACAGTGCTGTCTCCAACGCCAATCGAGGCGACCA
AAGCGCCAGCGAATCCGATGGTTCGAGTCCTTGTTGTTGTTGGCTTACAACTTGTTGATGCGCTGGGTTTGACTGACGGTTTCTTGTGTGGGTTGCTGCC
ATTGCTGTAGAACGAGAAGAAGCGCTTGCTGTTGGCTCAGAAAGAGCGACTTCGTGCAAAGATCGCTGCCAAGAGAGCCCCAGTACGGGAGTGAGACCAC
CACAATAGACTTGAGTGCGCAAAGAAGTTCTGCTGTCGTGACCAGCGAGTAAGTTACCAATACGTCCATCCCCATGTTCACCATTTCGTTCGGTCACCTC
GCATCTCTAGCCGAGCAACAATGACTCGCACAACACAGGAGCTCTAGTTAGAGGCGGCAGCTTCAGCCGCAGCCGCGGCGGCGTCGTCGGCCGCGTCCTT
CTCCGCGAGCACCTTCTTGAACTTGTTGACCTGCGACGCGAACGCCTGGTTGCACTTGTCCGTGAATGGCAGGCGCATGTCGTAGGCGTCTTCGCCATCA
GCGTAGTACCCCTTCTCGATATCGTACACCCTGATTAGACAGAAGATCACAGCGTCAGCTATGGGCTGCTTTCAACATGAACTTGTAAGCAGGACAGCGG
GATACGTACTGGTACTCTAGCGTCTTACGATACAAATGGATCGCCGCAGTGTTGCCCTCGCGTACGTGGAGCGACACGTACTCGGACTTGAAGCTCTCGA
CCATCGCGCGCTCTACGCATTCACAGAATAGATATGTGTGAGTGTCATCGCGCCATAGGTGTCATCACTGCCTCGGCATTCATTCTACGTACGCGCAGCC
TTCATGAGCTTCGTGGCGATACCGCACTTGCGGTGCGTGCGCAGCACCGCAAGCGACGTGATGTGACCGTGGGGCACCGACGCCTCTTCCTCCCTGCATC
AAACAAAACA