Description :
From Genome Similarity Track
Location :
Scaffold_35:157646- 159610
Sequence
1964 bases(100 bases per row)
GCTCGGATATCATGCCCGCACTCCAGCAGCGCCTCCACCTCGGGCAGCGGCAGCGGGTCGGTCCCTCTCAGCAAGTTCGTCCCAAGCAACGAGGAGACGG
ACCGAGCAGCTTGGGCTCGACAGCAGATAAGGCGGCTGCCTTGGCGGCGTCTGGGCTATTATAATCGACACTCTTCTCCCTCTGCTTGCTGGCGATGGTG
TTGCCGCTCGCCATCATTAGCCGAGCGCGTGCTTCATGTCGCTGAGCAATATAGATTGTCACCACTAATACACTGACAAACGTGTACGCATAAGGTGACA
TGTATTAGGATCGACTCGTTTTTGAATGTACTAGCGCCTCCGCCCGACCCAGAGGTGTACTTTCATCACTAGCCGTGCATCGTCCACGAGTGTTATCGCT
GCTAGGCACCCCCACGCTTCGCTCGTTTAGAATTTTCAGCGATAAACACTAGGTCCCGCACCAGCTCCGGCGTCAACGATCTCCTTTTGGCAGTGATGAT
GTTGCCACTGGTGGAAAATGCTCTTTCGGAAGGGACACTGGTCCTAACCACTTCCTTGCCAGGCGACTGAGATTAGGATAGTTGCTTCGATTTCCTGCCC
ACCACGCCACTTGCCTGCCTTACTAAGCGCGCGGGCCGCAGCCAAGTAGCTTTCAATCTCTTGAGCGCAGGCCTTCCTTAGAGGTGTTTGACTCGAGTCA
TCAGGAGAAGCTTTCAACACGAATTGAGTAAAGAAGTCCATCTTGTCAGGATCTGGTGATACAGCCGAAATAGAGCTCTGCGGTGGTGGTGATTGCAGCT
CGGCCAGCTCAACCGCAGCATCGAGAAAATCCGCGTGAGCTTTTGCTCGGTTTTCGTCTGTCAAGTGGCTCATTGACATTGCCATTCGTGGGTCCAAAAA
TGCAATCCAGACGAGCTTTGAGGTTTTGAGGGCATCAAAGCGCTCCGTGAACAACCGTCGCATTGCCGCTTGACATTCTAGCATTAAGACCCGGACTTCG
TCGACATAGGCTTCCCTACCAGCAGCACTTAGAATGTTGTTAAATAGTTCTCGGTTGCGAAGGACGCCTTCCAGCGCATCAAGAGCGGGCAGGACCACAG
GAAGTGTCGGATACAACTGTCCGTCCAGGGGTCTTGACACCGACTCAAATGGGCCCAACAATACACAAAGGCATCGGATAGCCAACCACTGCTTGTGTGT
TGGCTTCGATAGCTTTTTGTGCATTCCATCAAATTCCACTCGCCCCTCGTAAGTGAACAAATGCTCGAAAAATTTATCAAGCGCTGGCTCCAGTCGAATG
CACCGTTCAAGCATTGTCCAGCAGGAATTCCAACGCGTCGGGCAGTCGACGACCAGATTTATGACATCGCCCGGTTTAACGCGGAGGTGTTTCTTCTGAT
TTCAGCTAGACGGTTGTACGCTTTTGGTGACTTTCGGAAGTACACCGACAGAGTCCGAAACGCTTGCACAACCTCGCGCATAGACTCTAGCTCCGTTTTC
TCCAGGCTCAAAAGTGTTTCGGCCAGAAATGCATCCAACTCATCGATAGCATTTTCACGAAGAATCTCCATGTCCGCTCGTTCATCTTCATTCAGGTTGT
CATCTTCTTCGTTCTCATTCTCTAGCGCACCTGGCTCTTGCGCAACTACCGACTTCCACGCTGGTCTTGAATTCTGCGGCGACTCTTTCTTCTTCTTCTT
CTTCTTGGACAAGGCGCCCGATAGTACTAAGTGAAGCTCATGCGCCAAACACGGGGCGTGCTCGACGCCAAAACTGTCACCAGCAGCTACCATGTTAGAC
CCCAAATCATGGACAAATCGAGTACAATACTCTTTACGAAGCCTCCACACCTCCATTATCTCCTCCAACGCCAACCAAATCGCTGCAGCATCATGTTTCC
CAGGCAGCTCGCGTACTTCCAGCGTCCAGTTTCGCACCTCAAATGACTCGGTCAAATAGTGGAT