Description :
From Genome Similarity Track
Location :
Scaffold_22:157624- 160910
Transcript NameFunction/comments
Physo_132692hypothetical protein
Physo_114894hypothetical protein
Physo_132693Os05g0511300

Sequence
3286 bases(100 bases per row)
CTGACTGGCGAGCGCAAGTTCACTCTTGCGTATATTCATATCGGGTTTAAGAGGAGTAAATTTAGAGATTCCGGCATCCGTAAAATTGTAAAATTTCGAA
AGTGGCCGCATCAAAGCGGTGTGTGGCGCAGACAGACAGTGGACGAGCGGACCGAAGATGCTGGCGACTACGCGGAGACTGGCGGCGCGCTGCAGCGCCA
AGCCGCCGATGGCGGGCGCGCGCTCGTTCGCGGCCAAGGGCAAGGGCGCCGCGGCCGCGGTGGAGGAGGTCGTGGACCTGACCAAGGTGGTGCCCACCAA
CATCCTCAAGGACGGCGCCCACCCGGAGCTCAAGGACAAGTCCGAGTACCCGGACTGGCTGTTCACGCTGCTGGACCCCAAGCCCACGCTGGGCGAACTG
GAGCGCGCGGGCTTCGACAACCTGGAGATGGAGGAGCAGCACCGCTACCTCGTGCTGCTCAACCGCCGGACGGTCAAGGCCAACAACGCCGACAAGGCCA
AGAAGTAAGCTGGACGACGGACAGAGCACAATAGAGAGACGAGCACAGGGGCGGCAGCGAGGGTGGCGGTGGCTATGTGGTGTAGGGAGGGACACAGGCG
GATGCATGAACACAAGAATGAAGACGCGCGTGTGTTGGTTTTAGCAACTGGGGTTATCGTGTTCAGGCAGCACGAGTGCGACAACGGAGTCGTGCTGCAG
TCTGCACAGCAATTTCTTGTTCTGTCCGCGCGTCGGGCATTTTTATCGGCTGTGGCACTGCAGTGACTAGTTCTGGAACAGGTGTGCATGGTGCAGTCAG
ATTCGCTCGCGTTAAGCTGGTGCGTTTGTCTGACGCGATAACGTCGAACTGCGGTTTTCCTAGGACGTCGTCGGGAATCCTCCGGGCACGAGCTGCAGCA
GATGAAACGATGGAGAAATGTTAGCGAAAGACTGATTGCCGTCACGATCGGGCTAGCCGTTGCAGCACGAGCTGCGTACCAGGCAGACGTTGTTGCCGTT
GAGCAGCACCTGGTCCAGCTTCACCTCACGCTTTCCCTCCGGGGTGATTTCGCTGTAGGCGCAAGACGATAGAAAAACATTCCACAACAATTAGTCTCGC
CTGACTGGGCTCCATAGTGCAACCTGCGTCCTCGCACAGTACGGCGGCACTTACTACTCCGTCACGTCGTCCAGCACCATGTCTGCAGAAGGAAACCCCG
ACAAAGTGTATCAATGGTTAGCGTCCTCGGCTCTTTGGCAGTCCAAACTACAGCAAAAGCCGTAGAGAAGAACAGAACAAGCGCCTTTATCACTTACTAA
CGTAGTCGTCGAACCCCCGCAGCGTGCCGATGAACTCCTTGTCGCCCTTCATGACGATCCAGAGCTTCGAGCCGATGCACTTGTCAATGAGCTCTGCGAA
CAACAAACACCAGACAAAGCCACAAGCTGTTAGCACTACAGCGCACGCACTAAAGGGGCAAAACAGTCGGCTAGCTGCCGCGATGCGGACACGCACCGAG
CGGCAAGATGCGGCCTTGGGACATGGTTGCTTGAGTGTCGGCCGACCAATTGCTTGCGCTTTGTATCGGCGCGAGGCTGGCGATGTGGCGCACACCAATC
TGCCACCATCAAATCGCGCTGGCGGGTCAGTCATTCCGCGATCGATTGCCAGCACCATGGAGACGGACCCAGAGGAGCAGGAGCACTACCGCTCGGTGCT
GCTGTCGTTCCGCGAGTACGAGGGCTACATGATGCGCGAGATCTACCGGCGCAAGAAGCACCTGCAGTCCATGCCCATCGAGATGCAGCGCCGCCTGCCG
CAGTCCTCCACCATCCGCAACCTGCACCACTTCGTGAACGCGGCGCACCACAACCAGAGCTTCTTCGAGCGCGTGGTGCAGGCGCAGCTGGAGAACGGGC
CGGCCGTCGAGCTTCCCGAGGTCACGCCCAAGACGCCGCTGCAGAGCCCCCCGCGCCACTTCTCCAAGCTCAAGAGCACGCTGCACCAGTTCGTGCGCGA
CTGGTCCGACGAGGTCGGTTGGTCGCTGTCTTTGGAGCTGCAATGATGAGGCGGTATCTTACTGGCATTGCTCTTGTGCGTGCCTGTGTATTTGCTGCAG
GGCAAGAAGGAGCGCGACATGTGCTACACCCCCATTATCAAGGAGCTGCGTCGAGTGCTGCCGGTGAATGTGGACAGCCCGTAAGCAGTTGAGTCATGTG
CTTGAGGCAGCATGCAAGCGTTGCTGAGTATTGTTGTTTTGTGGGACAGGACCGAGCGTCCTCGTGTGCTGCTGCCCGGAGCTGGGCTGGGACGACTTGC
ATTGGAAATTGCTGCCAAGGGGTACGCCGTCCAGGGCAACGAGTTCTCGTACCAGATGCTGTTTGCGAGCAACTTTATTCTCAACTGGTAATGGTTTCTT
CGGCCTTGCTACTCGAGCTTTCCGTCTGTGGTCTCACAAGTAGATTTGCTATGCTGTTCGTCTGAAGTAGGGCCTCGCAGCCACTCGAGATCGAAATTCA
CCCGTGGATCCACAATCCGTCCAATGCGCTGACGATCACTGACCTGCTGCGTCCCGTTGCCATCCCGGACGTCGCACCAGCGGAGCTCCTGGGACTCAAC
AACGGCACTGCGGTCATCCCGCCGGACTTTTCCATGTGCGCGGGCGAGTTTCTGGAGGCGTACGCGAACGACAAAGGTAAGCGAAGCTGTCGTGCCATTA
TTGGTGAGATCATCGGTTAGGCTCATGTGAATCGATCGGGTCGTTGTGTGCAGAATGCTGGGACTGCATCGTGACGTGCTTCTTCATCGACGCGGCCCCC
AACGTGATCGAGTACATCGCCGCGTTCGAGCGCCTGCTGAAGCCTGGTGGCTACTGGATCAACCTGGGCCCTCTGCTCTACCACTGGCAGGACGCCGGCG
GTGACGAGGACGAGCGCTATGAGCAGTCGGTGGAGCTCTCGTACGAGGAGATCAAGCACGTCATGGGCACGTACAACTTCCGCATCCAGAAGGAGTCGCA
GCGCGAGTGCCTGTACACAAACAACGTCAAGAGTATGATGAAGACGGTTTTCAACTGCGCCTTCTTCACCGCCGTCAAGGAGGCCGGTCGTGTCTAGAAT
CTAGGCGAAGAAGGGTTGGAGAAGGCGCGAGCACAAGTCGTGTCTGATTATTGCCGATGGCTGTCCCCAAGGCTGTTGCGTCCTGTCTCGTTCCTTCTAA
ATACCAATCGTTACGTGTCCACTTTGCTTGTCACTTGGCTGCTGCTGCTGCTGCATCCCGCCAGGTCAGGTCAGGCCAGATCGTCG