Description :
From Genome Similarity Track
Location :
Scaffold_501:15762- 19428
Transcript NameFunction/comments
Phypl_g8933hypothetical protein

Sequence
3666 bases(100 bases per row)
TCGTCGAAATGTTGCACTCTCCATCTCCAGGCCGCATGAAAATATAAAGCCGCGCCAAGGCGCCAGCACCCCTCTGTGATTGAGGTGATGAGTTCGCCCG
TGGTAGAGGTCgtcgcctcgtcctcctgccTGAGCCTGGCCGCCACCTCCCAAATTGCGGTTGGTATAttgggcagctccagtcCGAAGCACGCCGTTTC
CACTTCCGCTTCTAGCAATCCAAGCTGTTTCCACTGATGCACAAATGTTGCGCGCAGTTGCTTGGCCGCCGGACATGTCCAAAAGACGTGGTACAGATCC
ACGTCTACCTCATGCACGCATTGTGCATGTGGGCATCCCAGCTTCCCATTTCTCATGTCGTACAACGAGTAAGCCCTGGACTTGAGGCGGTAGAGGACTT
GTGCTCCCCACGGCACTACCCCAAGTATGCGCCAGATCCGTATCCACTCCAGCTTGGCAAGCCCGTCGGCGgcttcgctgctgtgctcTCTCCATTTTGT
CGCCCTGCCCTGCTCTTGCTGGCGTCCTCGTCTATTAGACGCTTGCAGCACGCTTCTCGTAGTGCTGCGCGGTATGGCCCTGCGGTGGCCCGCCATCCGT
AGACTGACCATGCGAGCCACACCAGCAGTCAGCTCACTAATAAAAAAAGCAATTTATGCCACAGCAATAGTAAATATTGCCGCAATGTATATTGACTTTA
CCTGTCCTCGTCTACctgttcttcctcttccgcTTGTCCCGGTAGGCAGTCCTGTTGGTATGAATGCTCGTCGATCAACGGGCCACACAGTGCCCAGTTC
CTCCCGCTCAAAATCACCGATGATTTCTTGTGGCAAGTCGGCTGCCGGTTGCCACGTTGGTCGCGGGAAACCAACCCAGCCAACGAAGTAGTACGCGTCG
CCAGCCACGTTGGATTTCTTCGCGTAGATAAACTCGACCGTGAAGAGGTTGGGCCCCTCAAAGTCGGACCCGTCATTACCGGATGAGGTGCTGTCATGCT
CCTCACCAAGTGACGGGGAGCACCTTTGTATAGACGTCGCCCCCCCAACGAGCTCCGCCAGGCTCACACGGTGTATTGGCTGCTGGTGACGGGGCCCGCT
TGAACGCTTGGCATCAGCCAGTCTGCCGATCTGCGTGTTGCGCCTACTCTTCCTTAAATGCCTAGTGCTATACCAGTGCCACAACAGGCAATTTGAAGTG
CATTGCTAATTATATCTGATTGGGGTGCCTGAAATATCCACCGGTTCCACTGGAATAGATGGCTTGCTTCCTCGCACACGAAGCCAAACGACTGTAGGTA
AcggctggcgctggagacaGATGCCGCGTACTGAGCCTCGTAGCCCGGATGCTGCCCTGCCAGGTGGGTAATCAGGTTGGAGTATCCGGAGCCCGGAACT
TGTTTTCGATCGAGGCGGCACAGGTTGCAGCGAAATAGGCCTTGGCCTAGCGGAGCGAAGAAAAAGGAGGTGATCTGCTTGTTGGCGACCATTGCAGTTC
ACGGAAGATGAAGTTGTGAGCTCTCAAAGGCTTGTGGGCCTTGCCAAATCACCCCTGGATCGATGCGCTGCCAGCCAACGGATCGTTGGTGACGTGGCAG
TGGTGTGGAATACTTCACTGCTAATGTCATCGGCTCTAGCAAATGACACCATCGTGTGGTGGAGCTCAAAGGAGGGCAACAGTAAGCTACTTTTGCCTTA
CTTTTCAGGCTTACTTTTGCCATATTTATTGCCAATAATGGACCAATAAAATATTGTATTGGAGCTGGACAGATCAAATAATACATTTTTTGTGTGGAAA
ACCCAATTTATTACTGTATTGCCATATTTATTTCCGACCTCTGCTGGGGCATGCCGATCGCCGAGGGCTACTATGTGAATATTTACGACGTGACGGAGCA
GAAGGACCGGACGgacatgctgctgttggcgcagagcgagcgcttcgccgTCATCAAATGAGCGAGGGACAGCAGAGactgacagcagcatcagcgtaGC
GACCCGGTTCTCTTCGGCGTGGCTATTAGACTGAATGAAAGCTTAGTTGGTCTCAAGTGCCTTTATTACTCTTTATAAACCCCTACCTATTGCTATCTAA
CAGACGTGCTCAGACTGAAGCAAAAGGTGGAATGAGGAGCTCGTCCTCAACTTCCTACCTCTTTGCTTCCCTTCCTCATCGCACCAATATTTGCCTCGGT
CCGAGAGGCGGCAGGAGCCAATAGAGATTGGCTCCTCTACCAACCATGTGGTCGTAGTACCGTAGACTACATAGACGCTTCAAATGGCATAATGTAATCC
ATACAACATTATTATTCTGTCTCACACAGTACTGGGCCAGCCCATCCTTGGATCGTCTGTCGGTCTCTGCCGAACAGACGCATCCCTTGGTACTGGCCTC
CAGTGCTGGGCTAAACACTCCCACTAAGTGTCGTCCGTAGTCTTAAGGTCTTTGACCCCAATCAGTTATCTTAACTTAATGAACTGTCCTGTTGGCAGGG
CTTTTGTCAGTATGTAGGCTGCCATATCATTTGTCGAGCAGTACTGAATCTCCAATCGCCCTTCCTCCACGAGATCTCGTGTAAATAGGTATCTTATTTC
AATATGTTTCGTAGCTTTGTGGTTCCCAGGATTCTTTACCGTGGTGATGGCTGCCTTACTGTCACACCATACCTGTACTGGTTTATCTTGGGGAAATCCC
ATTTCTCTTAATAGGTACCATAGCCATTCGCTTTCCTTTGCTCCTTCACTCAGTGCGACGAGctctgcttcagcagtaGAAAGAGATACTGATCCTTGTT
TGCTGCTACACCACGATATACTGCTGCCAGCCATGGAGATGACATACCCTGTAACTGATTTACATTCTTTGGGTTGACACGCGAAGCTTGCGTCTGTGTA
CACTTCATACGCCACCGTTCTCGATTTTCCATCAAGAATTAGACCGTACGTTGACGTCCCTTTCAAGTATTTTAGGACTCTCCTGGCTGCCTGCCAGTGC
GTTTCGTTGTAGCACGACAAAAACTTACTCAGTTCTCTTACTGCATTGACAATGCCCGGCCTTGTTCCTCTGACCAGATACTGTAGCAATCCGACAAGCC
CTCTAAAGTCAAAATTTTGGACTGCTATTTGCTCAGCTGACAATTCTGTTTCAGCTTCGAGTTCCACGCTTTTGAGTTGTGGAGTCGATACTGGTAAACT
CTTTTCCATGTTGAACTTTTTCAACAGATCGTTAATGTAATTGTGTTGTGATATTGTCATGATCTTTTGTTCACGATTCCGACGGACCTCCATCTTAAGT
ATATAGTGGATGTCGCCCAGGTCTTTCATCTTGAATCTCGCAGAGAGATCTGTTTTCAGCTGGTTGATCACCCTCATGTCACGAGACATGATTGTCAGGT
CATCCACATAGATGACCACAATTATCCAATGCTCTCCCACTTTTTGGACGTAGATGCAGTATTCTTTGTTGCATCGGACAAAACCCAACTCTGTGAAGAA
CCTGTGGAGGATCTTGTACCAGATCTTTGGAGCTTGCTTAAGTCCATATATGCTCTTCTCGAGCTCACACACTAGTCCTTCATGGCCCGCTAGTTTGTAC
CCAGGAGGTTGGTGCATGTACACCTTCTGTTCAGCGTCCATTGACCCATTTAAAAAGGCTGTGTGA