Description :
From Genome Similarity Track
Location :
Scaffold_509:15760- 18205
Transcript NameFunction/comments
g9561.t1XP_008906610.1 hypothetical protein PPTG_12133 [Phytophthora parasitica INRA-310
g9562.t1hypothetical protein
g9563.t1hypothetical protein

Sequence
2445 bases(100 bases per row)
TATACATGCTGTACATGTGTGCCGGCGGCAGCGCAACCTTGGTGCTTCCGGCTGTGTTCGGCTTGATCCGCAGATCTCCAGTAGCAGTAATTGCCATGGG
AAGAGGTGGCGGCGGTGGGAAAGAACCTGGCACTGGAGTCATTGTAGACACGGCTAGCGGATTGGCCAGTAGCAAGTTCATTGGCGCTGTGGGAGGAGGA
GGGCCCGCTGCAGCCTCTGTGGTGGCTTTCACGAAAGCAGCGATGTGCTGGTGCGCGCGTAGCTGGTTCGCCAATGCCAGCCCTCCGTGTCCTTCCTCTT
CTGCATTCGCTCCTGGTTTTGCCCGTGGAACCTCCAACATGCCGTTCGTATTCTCCTTCATGATGGCACTGACGCCTTCCTCCTCGAGCACCTGGTGCCG
CGATTTGACCCACTGCTCCTTCGAGCGCTGGGTCTCGCGCTCCTTTTCTCCATCTTCAATGGCTTTCAGCAGTGCACCTCGCGGCGCTTTCTCCGCCAGT
CTCTTCTTGGGCTCATCAACCTTCTCTTCGGTGGTTGTAGATGCTTCTCCATCTGCAGACGCAGTAATCAGGTCCACCACAGCAGACTGCTCCGGTTCGT
CGCTCTTCGTCTGAAACACTCGCACCCTACTGGAGGCAGCGACTAGACTACTACTAGTGCAGTTACCATTGCCGTAGACACCGAACATCGAGTCGATGAA
CTCCGCCATCTCCATCAAGTCGCGGTGCAAAATGCGCTGGTAGCTACACACCAACGACATCAAGTCAGTGGCACTAGGGACCCTTTTGCAGATTTCTATG
CGCCTGCTGCACTCACGCGATGAGGCCTTCGACGTCCTGCTCTGCTTGGCACTCGGCCGCCGCGACGATCATGTCCTCATTGACAGTTAACATCTGCACG
GAACGAGCTGTGAGACTCGACGCTGCATCCAAACAGAGAGCCACGTACGTCTACAAACACGTCCGAGATGGAGGATGCACCGCCGTCCTCGTCGTCCGCC
GCAGACGCAGGCGGCGACTTCCAGCGCGAGGCGCTGCTGGCCATGGGGCAAAATTCATAATGGCGCGAGAAACTGATAGGGGCAAAGACACTCCTAATAG
AGGACCCTATTGTTGGCTCGATTTTGCTACTGTCCTTGAGCAGCCTCAAATGGCAGTAAATGGAGCTGCATGCACGAGTAGGGTGAAGTCATCACGCCTC
GACTGCCAAATAAATACGCTGTCTCTGTCTGTCTGGCGCTAATCACGCCTCGAAGTCGCTGTCGGAGATGTCCTCGTAGACCCACTCGTCGGCGTCGCCT
TCGACCGCGAACAGTTCTCCTTCTGCTCGACGCACAGGGCGGTTAGCGCTCAGATGGTCATGATGCAACCAATACCCATAAAGACAGCCGCTCACCGCTG
CACGTTTCCCAGTCGGCCATGTCGGCGGCCAGTCGCTCGGCCTGTGATCGCGCCGGTTGCTTCTTCTTCTGCTTCTTCGCGTTCGGCTTGGGTGGTGCCT
TTGGGCATGTATTTAGCTTCCGCTTCGCAGTTCCACTTGTCGACGACCACACATGTGCACGCTGTGCTTGTCGACTTGGCCTCGACGCAGCAGCAGTGGT
GGACTGTCCGGCCTGCACGTCCGCGAGCTCGCTGATCTGCGAGAGCACGTTCAGCTGCGACGCGGGCGACAGCCGCAGCTCTGTGCGTGAAGGCCGCAAC
GCTGAACGTCCTCTTGAACCTGCACGTGCTCCACATCAGTGCTCAGCCATTAGGCATCAATGAGGCAATGACACAGATGCACGTACTCGCAGGGGTTGAA
GCCTGCAACGCGCAAGGCTCCGCTGCACCCGCATCCTCCTCAGCCGTATGTCTCTCCCTCGCGTGAACTGCCGCGGTCCAAACGCACGGAGACAAGGATG
AGTCCTCCTCGTCGCCCAGTACAGTCTCGGCGTCGCTGCTGCAGGGCATCGTCACTCAAGTTGAAGTGGCTGGACACAAGTCGCACTTAGCGTAGTGGGT
TCGGATTATGCCTGGAACTGCGACACAATCCAATCCGCATTATGGAGCTGCGCTTCCGAGGCAAGAAGAGTGCAGAGGACGCGGACACCGTCGCGTTCTG
GTAGGCTACAGGTCGCAGGAGCGAGCCTCGTGTGTGTATGCCGCTTACTGACTGGGTCGCTGTCTGCTGCAGGCTGTGCGAGGGATCGAAGAAGCGCCGC
GTGCTGGGCAAAAAGTCGCTGCCGCTGGCTTTGGCCGCCGCCGAGTGGGATTTGCCGCACGTGCTAGAGAACGAGGAGCTGCACTGGATGAACGAGTCTA
CGGGCCTCGTGGTGCCTCGCGACCAGGAGCTGGGCAAGTTCGTCTCGGATAGGGATGTGGTCCGTCTCTGCTCGACGCAGGAGCTTGGCGCGCTGCTGGA
CAAGTTTGCCACGCGCGACCAGGAAGTGGCGGCGGAGATGATGCA