Description :
From Genome Similarity Track
Location :
Scaffold_461:15758- 17683
Transcript NameFunction/comments
Phyta_totarag8505hypothetical protein PHYSODRAFT_346416
Phyta_totarag8506hypothetical protein PHYSODRAFT_504002

Sequence
1925 bases(100 bases per row)
GTAGAAGTCTTGCAGAGCTAGTGGGGTAGGATCCGTCGTCCGTAGAGTTTACACGCTCTCGACCTTGTCCTTGGCTGCAGATACCGTCAGCTCCTGGTTC
TTGTCGCTACCGTCTTCGTTTGTCTGTCGTAAGCAGAGAGAGCACAACCACGTGAGGTTTCTATCCGTCCTCCCACCCACCAAGTTGCTTCGTCCTCTCA
CCTGCTCCATCAGGTCTCCGATggacttctccagctcgtcgataCGCGAACCCATTTCGTCGAGTGCACTTTCGCAATAGCAGCAAAACGCACACCAAAA
CAGTCAAGGAAACCCAACGCAAAATCCCCATCTCAATCTGCTACTGTAGCCCTCTAGGCCAGTAACAGTGACATGCTACACGCGAGGGTCATGATAAGGT
GAAAAGGATATTTCTTCCGATGATGGCGTCCGACATCTGCGCGAATCGCGATTGCTGCATGCAACACAACACAAAACCAACACTTGTCAGCAATTGCAAC
TCAGTCCAAAGACTGCAGTCGACAGTAGACCATAGCGACTACCACGCACCATTTGCTCCAGCAGACTTTGCACCTATTGTAGCAAAAAAACCACCGTCAC
AGCACACTCAGGATCAATGTAAATTGTACTGACAATACTGGGTATCATCCGGCTGAACACGTACGAAAACCGTGAGGTCCTGGGCGTCCGTGGGTCCGCC
GGCAGGAGCACTGGAGGCGCTGCCGTTCTTCGATGCGTCTGAGGAGCTCTACGAGGCGGAGAAGCGCGTTAGTACATCCCAAGACCATCATCATACACAT
GCACTCCCCACAGTTCCGCAATACGTCGCAGTCCTAGCGCACGAGCCGCCGGAAGACGTACCATTTCCTGTCTGATCTTCTGTGGGTTTCTGGAATCAGT
GCGTTCTCGAAAAGGCATATTTATTCGTTTTGATAGTTTTGTTTATCAGATCTGATTCTATAGTGAAGTTTGGCAAATCAGGCACAGATGCCACTGCCCA
GTCCCAAATTCGCCAGCTGAAGAACAAGTCTCCAAGTCTCACAAGCGTCACCATGGGGTGGACTTGTGTACAGTGCACGTTCCTGAACGCCAACGACTCG
GCCGGTAACTGCGGATCCTGCAACGCCATCCGCGTGCTGCAGTGCCCCACGTGCAAGGGCGAGATCAAGTCCGTCGTCTCTCTCTTACTCTCTCGCTTAG
GATCCCTGTGCATTTCTCATCTTCTAATTTATTGCTGCAGATATGGCAAGCGTCTCCATGTGAATGGCAAAACCTACCATCCTgactgcttctgctgcac
ggACTGCAAACGTCCGCTGCCGAGTCGCTTCCAAGTGGTGAATGGCGGCAACTATCACCCTGAATGTGTACCCAAACCCAAGTCCACCACCaagacgacc
accacgaccagaTCGTCgggcggcggtggcagcaagCCAGCGCAGAACGAgaaccgcagcagcaaagcaaaCGTCAAGGCTAATGGCAGTGCTAATACCG
CTAACGGTGCGGGCTGGCACTGCTCCACCTGCACATTTTTTAATGCCAACGATGCAGCACCGACCTGTGGAGCTTGCGATGCTGTCCGCATCATGCAGTG
TCCTGGTTGCAATCGAGAGATCAAGTAAGTTTGATGCAGTTTTATTGTGGGTGGGTACTGTTCGATGACTAGCAATTTGTTGGGTGTCAGATTTGGACCA
CGCGTCAATTTGAACGGCAAAGCATACCACCCGGATTGCTTCCGTTGCACTGCGTGCAATGAAAAGTTCCCGACGAACAAGTTCCAAGTCAAGGACGGCG
AGTACTACCACCATGAGTGCTacaagcagctcttccaccCACGGTAAGTGGCTTTCAGAGTGTGTATCGTCCTGAGCAGAGGAATTATCGCTTCATTATG
CACTGACATACGCTTGTAACTTGAA